Transcript asmbl_269005

Sequence
Transcript Sequence for observation asmbl_269005 of TGE0007664:
TTTTGTTTTGTTTTGTTTTGTTGTAAACCGGAAAAACAGTATCAGTAAGAAGACAATAATACTAATGGTATCTACATTGGCAAGTTGGTTTGAGGATCAGAGGAGAATATATATAATCTTTCCAAATTCTAAAGTGCTTCTTATTCTTAATGGAGCAGTTGCTCTTTGCATCACGACCAGAATTAATATGCTGGAGCATTACTACATTTTTTCACCCATGAGTAATTAATTTTGTTTTAAAAATTACCAGAGTAAAATTGACTCTTTTTCGGTGTGCATATATCTAAGAATTTTAACTTGTGTATAGATTTATGTAACTACCACCACAGTCACAGCTTTTGAGATTCTTTTTTCAAAGCGTTTCACATTCATATTGCAAAACACTTTTAAAAATAAGAAAAAGGGATTTAGATAAATGTGCTGAAGATGCAAATTAGTGAAACTGGCTTTTTTGCTCAAATCCCTGCAATCTCCAACCCCTTCAGGCCCTGGACCATTTTTGCTGTTGGCTCTGCAGGCTATCTCCTGCCACAAAAGTAATCAGAAATGGACTTGAGAGTTAGGGCCTTTCTTCACACTAAGCCCACGAGTCACAGACACAAACTTCAGCATTCCTTACTTGATCCTTTTATTACCAAATCTTAATTTCCCTAACTCTCTCTAATTGCGATTTCTCTCCAAAACGAAGAAGCCTGGAATAACCAGTACCTTCTCACCCTTTCAGAGAAATTATTTGATTGGGACAGAGGGAATACAGAGTTACTGAGAGAGCAAGGATAGGGCTTTCAGGACCCCAGACCTCTCCATTATAACAGATCCTTCAATCTGTCCCTTTCCCAACTCCATCCTCTCCACCTCCCCTGCCTGCGGGGTGCCTCCTAGGGCGTTAGACTTTAGAGCCAAGCATCTTCTCTCCATCCCAACCCCCCCGCCCCCCACCCCGTAAACTCTCCCAGTTTAAGTGACATGCACAGACACACTGTTGCCACATCTGGTGAGGAGGGCGGGTCCACTTTCCGGGTGACTCATGTCGTTACTATTTGTCTTTTGTTTCTAGGATGCTTTGGCTGCAATTTTCTTCCCTTTGTTTTTAATTTGGGAGGAGAAAAAGCTAATGAATCAAGAATGAATCTTCTCTCCACTAACCTTTTCTTTTCTTTCTTAAAGTTGGTTCTCTCTTCTCACAAGTTCCATAACTGTTAAGATGTGCGGGGGCGGGACAGGTGGGGACGCACTCTTTACACCTAAATCTGAAGTTGGCGCCTAAGGTATCACTTTGATGGTAAGACTTTTTGAAGCTTTCTTGCAGCTTGCTGGGCGTTTTGCTGCTGCCACTGGACAGTTTCAGCTCTTTTCTTTATGTTGTTGCTTCGCGCTGCTGTCCCGCCTAAATTTATCTCGTTACTCTCCTAAGTGTGAATCGGGGTGAATTCCACGAGATTCACTAGCGGATTTGTTCCTGTCCAAGGTAAATACAGTATGCAAAATGAGGAACCACCAAAAGATGCCGGGGAGGGGGAGAGAGGGATTCCCTCACCTTTTCCGGCACATTCCTCGTCAATTTCCACCAGGAGGAGGCGCGCAGCGCTGATCCCCTCCAGTCTCCTTTCTCAAATCTCCCTGCGGAGGGCTGTCAAGGTTGGCCGCGCGGCAGAAGTCCCTCTGGCCGGCCTAACCCTCCCCTGCCCCCAGGTTGGTTTTTCCCAGCTGCGGAGGTTGGGCCAGGGGCTGGGGTACTAGGAGAGTCAGCGACCGCCGCGCGGAGCTGGAAAGTCGCCGCGACTCCGGTGGGACTCGGAGTTGTCTCTGGAGGTGGCGGGCGCGGAGGTGAGCGGTTGGGAGCTAGCGGCGCAGGCGAGAATCGGGAGGCGGCGCCGGGGCCCCTCCCATCCTCTGGCGGGAGAGTAACCTAGGTCCCGGGTTTCACCGCTGCTTTGTTCGCGGCCTCTTCCCTCCCATTTGGAGATGACTGGAACCCCCTCTGGGATCCGAGGAGCAGGCGAAGGCTCGGGCTGGGGTGGGGGTGGGGTGTCATCTGCTGTAGGGTCCTTTGCTTTCTGTTAATCCGAGAGGGTACAAAAAGACATGAGAAGACGCTTGTAACCTGAAACTTCCCTCTCATCCATCTGGACCTGGAGGAGAGGTCCGGGCGGGGGCGCAGACCCGGAAGGCTGGTCGTCAGCGGAGGCGGTGAGGGAAGGAGCTGGGAGAGTGAGAAGTTTGGTCGGGAAGGCGCTGGGGATTAAGCAATAAGTTAGACGCGGGGGACGAGTCTGATAACGAAAGGAGGGCGGAAGGTTGGAGAGGTACATATAGTGTGGGCCAAGGCGGAAGGAAGATTGCGCTCCTGTCTTGGGGCGCGCGCCTCTCTCCCGGGTCCTGCAGCGGATCCAGCGCAAGGCGCCAACAAAAGAGGCGAGGAGGTGGCAACCCGGGGGCGGCGGCAGGAAGAGGAGCGGGAGTTGAGTGTCCACACCCGCTGTGCGTACTTTCTAGAGGGAAGGGGCGGGGGAATCGGCCCTGGGAGGAGGACATCCGGTGGTCAAGGGGTTAGCCAAGTTCTGGTTGCTGAGCCCTCCCACGAGAGGAAAGTTTTCTCTAGACACCTCCGGCCGACCCGCGCTCTCCGGGCCCAGCTCCCGAGCCTTCGGAGCGGGCTCTGTCCCAGCCCAGCTCCGGGGAGACCCGTGCCGTGATGCCTGGGGGGTGCTCCTGGGGCCCCGCCGCCGGGGACGCTCGGCTGTGGCTGGCGGTGGTCCTCCTGGGCTGGGTCACCTCGTCCTCACTCACCTCCTCGGCGACGTCCTCCACCTCCTCCGCGCAGTTCCTGGCCTCCGCGGTGTCCGCACAGCCCCCGCTGCCAGGCCAGTGCCCCCCGCCATGCGAGTGCTCCGAGGCGGCGCGCACCGTCAAGTGCGTTAACCGCAACCTGACCGAGGTGCCAGCGGACTTGCCCCCTTATGTGCGCAACCTCTTCCTCACCGGCGATCAGCTGGCGGTGCTCCCTGCCGGCGCCTTCGCCCGCAGACCGCCGCTGGACGAGCTGACCGCGCTCAACCTCAGCGGCAGCCGCCTAAAGGAGGTGCACGCTGGCGCCTTCGAGCAACTGCCCAGCTTGCGCCAGCTCGACCTTAGCCACAACCCGCTGGACGACCTCAGCCCCTTCGCTTTCTCGGGCAGAAACGCCAGCGCCTCTGCCCCCAGCCCTCTGGTGGAACTGTTCCTGAACCACATCCTGCCTCCTGAGTTCGATCGAGAGAACCGTAGCTTCGAAGGTATGGTGGCAGCGGCCCTGCGAGCTGGCCAGGCTCTGCGCGGGCTCCACCGCCTGGAGCTGACCAGCAACCACTTGCTCTATCTGCCCCGCGACGTACTGGCACAAATGCCGGCCCTTAGGCACCTGGACCTGCGTAACAACTCGTTGGTGAGCCTGACTTATGTGTCCTTCCGCAACCTGACACACCTAGAAAGCCTCCACCTGGAGGACAACTCCCTCAAGGTCCTTCATAACGGCACCCTGGCAGAGTTGCAGGGCCTGCCCCAAGTCAGGGTCTTTCTGGACAACAATCCCTGGGTATGCGACTGCCACATGGTGGACATGGTGGCCTGGCTCAAGGAGACAGAGGTCGTGCAGGGCAAAGCTAGGCTCACCTGTGCATTCCCTGAAAAAATGAGGAATCGGGTCCTCTTGGAACTCAACAGCTCAGACCTGGACTGTGATCCTATCCTCCCTCCATCCCTGCAGACTTCTTATGTCTTCCTAGGTATTGTTTTAGCCCTGATAGGCGCGATTTTCCTACTGGTTTTGTATTTGAACCGCAAGGGGATAAAAAAGTGGATGCATAACATCAGAGATGCCTGCAGGGATCACATGGAAGGGTATCATTACAGATATGAAATCAATGCGGACCCCAGGTTAACAAACCTCAGTTCTAATTCGGATGTCTGAGAGACAATCGAGGACAAAACAAGGACAGCTATGCATGAGATGTAGACTTAAGCTTTATCTCATCCTATGCTTGCTCCATCTCCACTATCCACTATAGACACCACTGACCTTGACTGAAAGCAGTGAAGGGACTTTCCTTCCTTGTCATGTAAAGTTTTTTGGTGTGTTCTATTACTGTAAGATGATAAACAATTGCATAGTCTTTTACCTTCTTCCTTTTCTTGGAACTCCTTAATACAGGTGGAGGGATTTTTCAAGTTTCAGCATGAACATGGACTCCTGGCTGTCTGTTTCTCTTAGCACACACAGTTCAAGGTGTAGCAAGTGTACCCACACAGACAGCATTCAACAAAAGCTGCCTCAACTTTTTTGAGAAAAATACTCTATTCTTAAGTATCAGTTTTATTCTCATGTACCTAAATTGTGGAGAAAATGATTGCATTCCATAAACTGCCTGCAGACCTTAGCAAGCTCTTCAAAGTAACTCCATAGTACACTGGAGCACCTGCATCCGAGAGCATGCTTACATTTTACTGTTCTGCATATTACAAAAAAATAACTTGCAACTTCAGATAACTTCTTTGACTAAGTAAATTACATTTTTGACTGCAGTTTATATGAAACTATATGGAAGGTTTTTTTATAAACTGCATCGAGATCCAAAAGGCTAAATTGTTTTAAAAGAAATCAATAAAGATTCCTAAAAGAATTACAGTTGTGTTCAAGTTTGATATTTGAAAAAAGGATGAGGGACAATGATATTGAAGGGTCTTGGTTCCAGTGATAATTAAGGTATTAGTTATAGCTGAGCATGAAACTGGAACAATATCATATAAATAGACTTCAGAGATAATTTCGAGATGGTGGATCCTTTCAGGATTTAGAAATTTTGAATATTTATGTGAATAGACTTCTTGTGGTCCCAAAGTTAATGCTATTCAAGAAACAATTTTGTGAGAGCATTACAAAGTTGGTAAGAGGGAAGAATTCTATATGATAAACAGTTCACAGTTTGGGGCTTTTTCTAGACTAAGTTTTTAGGATAGAACAAAATTATTTACTTAAACTCTCCATATGAAATTGTTCTATAGGTGTTTAGAGTATACAACAAATATGGTGCAAATAAATGTATGAAAATTAAGTGTCTTAAAGGTAGAATATACTAAAAGATTTTAAAATATAAAGTTTTCCTAAGATCATAATACAAATTGAAACAGACTTTCTTGAGAATATTTTTTTTAAAAAAATGGAACATACACAGTGGATAGTTTATCAGAGACCCTGCTAATATGTTTAAAAAATTGTAATGATGGGGTAGGAGTTTGAGGAAATAACCGGAGATAAATGTATGTGTTCATAAACAAGTGTCTCGACTAATCATAGTTTCTTATGTTTAGTTCAGTATTTATAAATATGAGGATATTTTGATTTAGATAAGCTATATGTTGGTATATACACCTTTGTGAGGAATAAAATCCCATTTAGGTTTAAATAAAAGCAATCGGTTAATCAATTGATATTCTCTGAGTTAAATTCAGAAGTGTTCAAAATAGGGCTAAAATCATGATATCTGTTCTTTCTGTAGACTACACAGTCAGAATATGAATTTTAACTATATTAACTTTCATAAGGTTTATTTTATAAAATGTAACATTTGTTATTTATGGTTATACTTCAGATCCTATGAAAAAGTTAAATATATGGTACTTAACATTCCGTTAAACGTTTTAAGTGTTCATCAGGAATTCATAAACTGGCTGCTTGCCATTATTTCCAAAGAATGATAAAGATATGAGCGTGCCAAAAATAGTGAAAACATATAATAAGAGCACACACATGTTAGGAATAAACTGCTGATGGACTTTAGTAAGTCTGCTGATATTGTAGAAAACAAATTGTAATATTTGTAGTCGCTATTCAGAAGAATTATTTTTCCATCATGTGATAATCTAACAGTTAAAAACTGAGCTTTATGCTAGATCCAGGAAAGCAGTAGTTTCATTAGTCTAGCTTTTCTCATCATCAACTCACTGAAGCAGAATCTGATGAAGTGAAGCCAAGTTTTCATCTGTTAGGTGGATGGCTTTTTTTAAGTTATAATTTCTTGCTTCTTTTTCATTCCCTTGCTTCTTTCTCTGTATGAACTTCCGAATATGCCACTGCTCTCTTTTCTATCATATCACTCCTTGCTATTTTCTAGTACATGGCAATAGAACATTCTTAAGGTAAAAAATATTACTGTTTGAAAACAATTGGTATTGTGCAGTCATAATACTCTAAGTCTATAAGCTTATAAGGCATTTTGAGTTCCTTGGAAGATAGGAGCTATATAAACCCAGTAAGTACAAGGGAATATAAGAAAAATGAAATTAAAAGTATCATTTTAAGTGTACTTGTATTAAGCACTGTTCTTTAGTACCATTATGCATTATTGATCCTAGAAACCTACAAGTAATCCATTTTAAAAAATTTATTTTGGTTGATAATACACTATTACTCAGCTTAGCAAAGGTTTCAGAGAAAACACCATTTATCCTTTACAAGTTTCATCTGAAGAAAGTTAGAAGAATATAGGTTTCCCCCGCCATCTGAAAGTAGAGTATTCTAATGAAAACTTCTGAAGGCTGAAATGATGTAAAGTGAAGAAGCAATTACCATTAGTTTAAAAGCAAAAATCTTCTTCAAATTTCTTTTGGTTAGTGGAAAACAGGTACTAAAGCTGGTCTTTTGTAAAAGTCAAGTGGCCTAACTCAAACTTTCAAAAAGCATGGAATACCTGTACTTAAAAACTTAAGCACTTGATAAATCTTTCAATTTAAAAAGCTATTAACATGTCCAAAAAATCTTAACTTAGTGGCAAGATTTTAGGATAATATGGCTATTTGCCCCTGGATTGTAAAACTCCACTTTCAATGTAACCATTCAGTTTGCAGCATTTAATATATGTATTGACAGTTTTGCTGTCTCATGTAATTATGGTGACCTATAAGGCACATTTGTTATCTTATAGCCGATAGGTTTTTCTTACAAAATAAGTAGACTTTGAAGCGTATTTGCTAAAATTTTTTAAAGAAAAAGGAGCCACAAAAATTGATACTATCAATAAAAGACAAGATTTTTTTTTCAAAGGCAAAGAAAGTCTTCATGGAAATAAATGAGCAAATCACAAATGGTAAATCCTTTTAAAATATCTTGAATGGCAGCAAATGTGGATCATGCACACCTTAATATTTAAATAGAAATAACTTACATCTTTGTTTTCTGTCTGTTTAATTAAAGTGGATGTAAAAAAGAAAGGTCCAAATGAACTGATTGTTTCCTTAGGATTCTGTTTTCTTCTGTCCCTTCTGGTCTAATGTTCCAATACTGTGCTTAACATTCTTGAGGACATTAGAGGCTTTACAGCTCTAGTTTGGGGCTCCTTTGTATCATTTCTATTTTCCATTTAAAATCTTCCCTAAAGTCTACACAAAAAGACACCATGAGGATGTACAAGGTTAAAAACAGTTAGATATATGCTTTATTCCTGCCCCCAAATCCATTAAATTATCCAGTTTTCAGAGAGCAGCATCATAAAGTGAAGACAAATATTTATTAGATGAGATTCACGTTTCACTTCTACACTTGTGCAAGGATTTTTCACAGTAAAGGAGAGGGAAAGAAGGAAATTATATTTCTAGTAATATATGAAAAATACTTTGACAATGTCTTTAAACTCTTTCAGTAAAACTGTAATTCTACACTTGAAATAATTAGTTTAAGAAAATATATTCTGTATTGTGCAGGCGATCTTGTCTTCTAAATGGAGAAAAACAGCTCTTGGAGGATGTTTTGTACAGCTATTTTTCTGTTCTTATCCTTAGAAACATTTGACTCAAAAATGCAGGCTGCTTTTATTTTGTATTTTATCTTAAAACATTTTAGCAGCTCTAAATCTTTAGTGTCATGGGTTAAAAATATCTATATTTAAAAAAATATTTAATATACGATTCATATAATTTTTACAAAAAAACCACGAATTCTTAGTATTTCAAAATTGGAAGGGCTCTTAGATGTGTCAAGCCCAGTTTCCCATTCTACAAATGAAGAAATTGTTAATTGTAACATATCATATATAACGACAACCAGGACTAGATCTCAGGATTCCAGACTCCGCCTCTAGTGCTCTTTCTTTTCCACATGATGGCATTATTAATAACCTACCTTGAGACCTTTGAAATTCCCATGTTTAATAAAAAGAGGCAATTGCCATGGTTTTGTTTTTGCTTTGCTCTCATTCAGTTTCAGTTGGCTCTAAATTTTATAGTATGCTTCAGATCCCTGAATATGCTTAAATATGTTTGAAATGACTTTGTCATAGCAATCTTATTATGAAGCTCCTCTGAGTCTATAATATGATAGAAAATATTTTGGTAGTTTAATGGTGATAATTCTTTTGAAAAGAAAAATAAAACTCTGGAAAGTTGTGCTAGCTTGTGTAATTCTATCTTAAAAAATGAGTTAGCTCAGCTGGTGAGAACACTAAACAAATGAGACCAAGTTCATGGCCACAAAGTCAGTCATTCCGTCACCAGGTGAGACAGTCAGCTTTGCATGCTCTGCTCTGCCCTCTAAGGCCACACCCACTCCAGGTGCATTGCTATAACCCATCCTCTGAGGGCCTAGACCAAACGGAATCTAAATCAATGCAAAACTATTATCACTCTGGAAAACCAGTGGACTTACCAGCCAAACCTTGGCAGCACAGCTGCTGATGGGCCCGTTCACTTTCTTTACATATATGTAGGACCAAACATGGCAGTCTCTATATCCTCAAATTATAGTATGTATGCCACAGATCACAAAAGTTTTCTCATTTATGTGAATTTTGAGAAAAACCTATGATCAGTATCTTTTAATGTATTACACAGGAAATTAGGTTTGCTTTGCTACTTGAAAATGTGGTTTAAGATTAAAGATAATGATTACTATATCACAAACTTGTATGTAAATGTTCATAAGAACAGGAATGCAGTTTATGTTTAGCTGACATTTTATGATAATAGGGGTTATTTGTGGTTCACAGTTTAATTGTAAGGATACAATTGTTTTCAAGGAAGCAAAAGCTTAAAATATGGCCAGCTATAATAGTTTTTTTGACAAGCAAATATTTAATAATATGTTTTAAAGAACCTGAGGATGCCATCAAGATAGGCTTATTTTAAAATAGAAATTTATAGATTTCCCTACTCCCTTACTCCCATCCCCACAATCTTATTTCTACTACTTTTTGTTTTTTTCCCCCAAAGAGAACCACGATACATAACATTTCAAGGTGACTGCTTGCACACTGGAGAATTAGACTGACTAAAATATTAGGTGGGTCAGTGTACAAATATACATTTCTCTACATGAAGCAGTTTCTCTCAGTTTTACAATACAGTTAGCCAACTGTTAGAAGACTCTATCTTTCAATTAGACACGTTCTGTGGTTATTCTTACAGATCATGGAAAACACAGCTATAAAACTTTTAAAAGACATTTTAAAATTAACTCATGTTTCTTGTAGATTATTTAAAAACACAGGGTTGGGTGGACACCATGAATAGTCTTACCGCTAAGGAAAAAGTGCCTTAATATTGAGATAAACCACCATCTGTTTAAATCACATTGTATCTTGCCTTTTCACTTACAATGCTGAGAACATTCTCCAGTATCATTAAAAACTTTTAATATCTGGTTTTAAAGTACTGCAGACAATCACATATTTTACACATATAGGGTGTTTCTTACAATTTTACCTAATGTTCTAATACCTGTGTTTCTGTATCTCTCATTTTCTCCTTAAAGTAGATCTTTGAAGGAGAATTACTGCATCAGAGGGTATAATCTATTTTCTAACCTCTATTTAAATTAGGAATATTAAATGTACATCATCAGTTAACTATATGTTTTAGGAGTCTCACATCATACTTTTTACAGAGTACTGAATAGTCTGTGGACAGGATCATGAACAGAAAGAAACTTTGATTAAGTTGCTAATTTACTTGTCACTGTTTTTAATTCACAGATGTCTACGCATTGTTAAAATAACAAAATTAGAGGATAGCTAACCCCATAACTCAGGAGGGAGGGAGAGAAACAGAGAGAAGTGGGGAGAGAGAGTCAGACTCAATTATGATTCACCACTGATGTTTGATTGATGACTGAAATGTACTACGTCTCATTTAATTGATTTTGAACTTGTGTAAGTAAGCCAGTATGGCTCCCTTTGAGGCTTATAGCATGTGGCCATAAAGGGAGGTGAAAGTTCCATTGAATGCCTTATTCAAGAGTCTGTGGTATGTATGTTGAGGAGTGAAATGCATGCCTTGGTTACCATCAATAATGTCTGGAATTCTGAAGAGGTTAAGAAGTGTCTTGGTGAGGCTTTTTATTTTGGCTTTAGTATGGGCAGACCTGTGTGACCTTGATTCATATTTTGGGTATCTGCGAGGCAAGAAATCCCCAGTTTTTTAGCCAAAAGAAGGTGACCTTGGAAGACTAATCTGGCAGCAATGAATGGAGAGACAGGAAACAAGTGACTTATTTCAGTAGTTAAGGTAAGAAGGTCTTTTATAGTGGTTTTTAATTCACAAATTAAAAAGTTTCCTTGGTCAAGTTTAAAGATGCTGTTACTCTTTTTCGAGTCAGTTCTTAGGACCAGTTGGTTTTAATTTCTGAATGAATGAATTGAGAAGAATGGCTGTATCCAATAACCAGAGCGTTCCCTACTCTATTCCTTCTTGTTCTCTTCCATCCTTTGATAGATGCTCTAATGAGAAATGAATTCACCAGAGAGATTGCTTGAACAAATCTGCAATCTTAATAATTTAATACTGGCTAACCGAGTTAAACATTGGATGATATTATGTTCTAATAGTCCTTACAGTAAGTTGATTACATATAGGTAAGGTAGTTTTAATTAGCTTTATACTACATGCTGCAGAGACATTTTGTATTACTTCAGGAAGTGCTTCTTATTTAAGAAGTGACATATTTCATAATTCCTTATGTCATAGTTATATACTCTAGGCCCCATTCTTAGTACTTTATTAATAAGTAATTTTTTTCTCTTAATGGGACAATGTGGTAGGAACTATTTCATAGATGAGGAAACTGAGGC