Transcript asmbl_269004

Sequence
Transcript Sequence for observation asmbl_269004 of TGE0007664:
TTTTGTTTTGTTTTGTTTTGTTGTAAACCGGAAAAACAGTATCAGTAAGAAGACAATAATACTAATGGTATCTACATTGGCAAGTTGGTTTGAGGATCAGAGGAGAATATATATAATCTTTCCAAATTCTAAAGTGCTTCTTATTCTTAATGGAGCAGTTGCTCTTTGCATCACGACCAGAATTAATATGCTGGAGCATTACTACATTTTTTCACCCATGAGTAATTAATTTTGTTTTAAAAATTACCAGAGTAAAATTGACTCTTTTTCGGTGTGCATATATCTAAGAATTTTAACTTGTGTATAGATTTATGTAACTACCACCACAGTCACAGCTTTTGAGATTCTTTTTTCAAAGCGTTTCACATTCATATTGCAAAACACTTTTAAAAATAAGAAAAAGGGATTTAGATAAATGTGCTGAAGATGCAAATTAGTGAAACTGGCTTTTTTGCTCAAATCCCTGCAATCTCCAACCCCTTCAGGCCCTGGACCATTTTTGCTGTTGGCTCTGCAGGCTATCTCCTGCCACAAAAGTAATCAGAAATGGACTTGAGAGTTAGGGCCTTTCTTCACACTAAGCCCACGAGTCACAGACACAAACTTCAGCATTCCTTACTTGATCCTTTTATTACCAAATCTTAATTTCCCTAACTCTCTCTAATTGCGATTTCTCTCCAAAACGAAGAAGCCTGGAATAACCAGTACCTTCTCACCCTTTCAGAGAAATTATTTGATTGGGACAGAGGGAATACAGAGTTACTGAGAGAGCAAGGATAGGGCTTTCAGGACCCCAGACCTCTCCATTATAACAGATCCTTCAATCTGTCCCTTTCCCAACTCCATCCTCTCCACCTCCCCTGCCTGCGGGGTGCCTCCTAGGGCGTTAGACTTTAGAGCCAAGCATCTTCTCTCCATCCCAACCCCCCCGCCCCCCACCCCGTAAACTCTCCCAGTTTAAGTGACATGCACAGACACACTGTTGCCACATCTGGTGAGGAGGGCGGGTCCACTTTCCGGGTGACTCATGTCGTTACTATTTGTCTTTTGTTTCTAGGATGCTTTGGCTGCAATTTTCTTCCCTTTGTTTTTAATTTGGGAGGAGAAAAAGCTAATGAATCAAGAATGAATCTTCTCTCCACTAACCTTTTCTTTTCTTTCTTAAAGTTGGTTCTCTCTTCTCACAAGTTCCATAACTGTTAAGATGTGCGGGGGCGGGACAGGTGGGGACGCACTCTTTACACCTAAATCTGAAGTTGGCGCCTAAGGTATCACTTTGATGGTAAGACTTTTTGAAGCTTTCTTGCAGCTTGCTGGGCGTTTTGCTGCTGCCACTGGACAGTTTCAGCTCTTTTCTTTATGTTGTTGCTTCGCGCTGCTGTCCCGCCTAAATTTATCTCGTTACTCTCCTAAGTGTGAATCGGGGTGAATTCCACGAGATTCACTAGCGGATTTGTTCCTGTCCAAGGAGGAGGCGCGCAGCGCTGATCCCCTCCAGTCTCCTTTCTCAAATCTCCCTGCGGAGGGCTGTCAAGGTTGGCCGCGCGGCAGAAGTCCCTCTGGCCGGCCTAACCCTCCCCTGCCCCCAGGTTGGTTTTTCCCAGCTGCGGAGGTTGGGCCAGGGGCTGGGGTACTAGGAGAGTCAGCGACCGCCGCGCGGAGCTGGAAAGTCGCCGCGACTCCGGTGGGACTCGGAGTTGTCTCTGGAGGTGGCGGGCGCGGAGGTGAGCGGTTGGGAGCTAGCGGCGCAGGCGAGAATCGGGAGGCGGCGCCGGGGCCCCTCCCATCCTCTGGCGGGAGAGTAACCTAGGTCCCGGGTTTCACCGCTGCTTTGTTCGCGGCCTCTTCCCTCCCATTTGGAGATGACTGGAACCCCCTCTGGGATCCGAGGAGCAGGCGAAGGCTCGGGCTGGGGTGGGGGTGGGGTGTCATCTGCTGTAGGGTCCTTTGCTTTCTGTTAATCCGAGAGGGTACAAAAAGACATGAGAAGACGCTTGTAACCTGAAACTTCCCTCTCATCCATCTGGACCTGGAGGAGAGGTCCGGGCGGGGGCGCAGACCCGGAAGGCTGGTCGTCAGCGGAGGCGGTGAGGGAAGGAGCTGGGAGAGTGAGAAGTTTGGTCGGGAAGGCGCTGGGGATTAAGCAATAAGTTAGACGCGGGGGACGAGTCTGATAACGAAAGGAGGGCGGAAGGTTGGAGAGGTACATATAGTGTGGGCCAAGGCGGAAGGAAGATTGCGCTCCTGTCTTGGGGCGCGCGCCTCTCTCCCGGGTCCTGCAGCGGATCCAGCGCAAGGCGCCAACAAAAGAGGCGAGGAGGTGGCAACCCGGGGGCGGCGGCAGGAAGAGGAGCGGGAGTTGAGTGTCCACACCCGCTGTGCGTACTTTCTAGAGGGAAGGGGCGGGGGAATCGGCCCTGGGAGGAGGACATCCGGTGGTCAAGGGGTTAGCCAAGTTCTGGTTGCTGAGCCCTCCCACGAGAGGAAAGTTTTCTCTAGACACCTCCGGCCGACCCGCGCTCTCCGGGCCCAGCTCCCGAGCCTTCGGAGCGGGCTCTGTCCCAGCCCAGCTCCGGGGAGACCCGTGCCGTGATGCCTGGGGGGTGCTCCTGGGGCCCCGCCGCCGGGGACGCTCGGCTGTGGCTGGCGGTGGTCCTCCTGGGCTGGGTCACCTCGTCCTCACTCACCTCCTCGGCGACGTCCTCCACCTCCTCCGCGCAGTTCCTGGCCTCCGCGGTGTCCGCACAGCCCCCGCTGCCAGGCCAGTGCCCCCCGCCATGCGAGTGCTCCGAGGCGGCGCGCACCGTCAAGTGCGTTAACCGCAACCTGACCGAGGTGCCAGCGGACTTGCCCCCTTATGTGCGCAACCTCTTCCTCACCGGCGATCAGCTGGCGGTGCTCCCTGCCGGCGCCTTCGCCCGCAGACCGCCGCTGGACGAGCTGACCGCGCTCAACCTCAGCGGCAGCCGCCTAAAGGAGGTGCACGCTGGCGCCTTCGAGCAACTGCCCAGCTTGCGCCAGCTCGACCTTAGCCACAACCCGCTGGACGACCTCAGCCCCTTCGCTTTCTCGGGCAGAAACGCCAGCGCCTCTGCCCCCAGCCCTCTGGTGGAACTGTTCCTGAACCACATCCTGCCTCCTGAGTTCGATCGAGAGAACCGTAGCTTCGAAGGTATGGTGGCAGCGGCCCTGCGAGCTGGCCAGGCTCTGCGCGGGCTCCACCGCCTGGAGCTGACCAGCAACCACTTGCTCTATCTGCCCCGCGACGTACTGGCACAAATGCCGGCCCTTAGGCACCTGGACCTGCGTAACAACTCGTTGGTGAGCCTGACTTATGTGTCCTTCCGCAACCTGACACACCTAGAAAGCCTCCACCTGGAGGACAACTCCCTCAAGGTCCTTCATAACGGCACCCTGGCAGAGTTGCAGGGCCTGCCCCAAGTCAGGGTCTTTCTGGACAACAATCCCTGGGTATGCGACTGCCACATGGTGGACATGGTGGCCTGGCTCAAGGAGACAGAGGTCGTGCAGGGCAAAGCTAGGCTCACCTGTGCATTCCCTGAAAAAATGAGGAATCGGGTCCTCTTGGAACTCAACAGCTCAGACCTGGACTGTGATCCTATCCTCCCTCCATCCCTGCAGACTTCTTATGTCTTCCTAGGTATTGTTTTAGCCCTGATAGGCGCGATTTTCCTACTGGTTTTGTATTTGAACCGCAAGGGGATAAAAAAGTGGATGCATAACATCAGAGATGCCTGCAGGGATCACATGGAAGGGTATCATTACAGATATGAAATCAATGCGGACCCCAGGTTAACAAACCTCAGTTCTAATTCGGATGTCTGAGAGACAATCGAGGACAAAACAAGGACAGCTATGCATGAGATGTAGACTTAAGCTTTATCTCATCCTATGCTTGCTCCATCTCCACTATCCACTATAGACACCACTGACCTTGACTGAAAGCAGTGAAGGGACTTTCCTTCCTTGTCATGTAAAGTTTTTTGGTGTGTTCTATTACTGTAAGATGATAAACAATTGCATAGTCTTTTACCTTCTTCCTTTTCTTGGAACTCCTTAATACAGGTGGAGGGATTTTTCAAGTTTCAGCATGAACATGGACTCCTGGCTGTCTGTTTCTCTTAGCACACACAGTTCAAGGTGTAGCAAGTGTACCCACACAGACAGCATTCAACAAAAGCTGCCTCAACTTTTTTGAGAAAAATACTCTATTCTTAAGTATCAGTTTTATTCTCATGTACCTAAATTGTGGAGAAAATGATTGCATTCCATAAACTGCCTGCAGACCTTAGCAAGCTCTTCAAAGTAACTCCATAGTACACTGGAGCACCTGCATCCGAGAGCATGCTTACATTTTACTGTTCTGCATATTACAAAAAAATAACTTGCAACTTCAGATAACTTCTTTGACTAAGTAAATTACATTTTTGACTGCAGTTTATATGAAACTATATGGAAGGTTTTTTTATAAACTGCATCGAGATCCAAAAGGCTAAATTGTTTTAAAAGAAATCAATAAAGATTCCTAAAAGAATTACAGTTGTGTTCAAGTTTGATATTTGAAAAAAGGATGAGGGACAATGATATTGAAGGGTCTTGGTTCCAGTGATAATTAAGGTATTAGTTATAGCTGAGCATGAAACTGGAACAATATCATATAAATAGACTTCAGAGATAATTTCGAGATGGTGGATCCTTTCAGGATTTAGAAATTTTGAATATTTATGTGAATAGACTTCTTGTGGTCCCAAAGTTAATGCTATTCAAGAAACAATTTTGTGAGAGCATTACAAAGTTGGTAAGAGGGAAGAATTCTATATGATAAACAGTTCACAGTTTGGGGCTTTTTCTAGACTAAGTTTTTAGGATAGAACAAAATTATTTACTTAAACTCTCCATATGAAATTGTTCTATAGGTGTTTAGAGTATACAACAAATATGGTGCAAATAAATGTATGAAAATTAAGTGTCTTAAAGGTAGAATATACTAAAAGATTTTAAAATATAAAGTTTTCCTAAGATCATAATACAAATTGAAACAGACTTTCTTGAGAATATTTTTTTTAAAAAAATGGAACATACACAGTGGATAGTTTATCAGAGACCCTGCTAATATGTTTAAAAAATTGTAATGATGGGGTAGGAGTTTGAGGAAATAACCGGAGATAAATGTATGTGTTCATAAACAAGTGTCTCGACTAATCATAGTTTCTTATGTTTAGTTCAGTATTTATAAATATGAGGATATTTTGATTTAGATAAGCTATATGTTGGTATATACACCTTTGTGAGGAATAAAATCCCATTTAGGTTTAAATAAAAGCAATCGGTTAATCAATTGATATTCTCTGAGTTAAATTCAGAAGTGTTCAAAATAGGGCTAAAATCATGATATCTGTTCTTTCTGTAGACTACACAGTCAGAATATGAATTTTAACTATATTAACTTTCATAAGGTTTATTTTATAAAATGTAACATTTGTTATTTATGGTTATACTTCAGATCCTATGAAAAAGTTAAATATATGGTACTTAACATTCCGTTAAACGTTTTAAGTGTTCATCAGGAATTCATAAACTGGCTGCTTGCCATTATTTCCAAAGAATGATAAAGATATGAGCGTGCCAAAAATAGTGAAAACATATAATAAGAGCACACACATGTTAGGAATAAACTGCTGATGGACTTTAGTAAGTCTGCTGATATTGTAGAAAACAAATTGTAATATTTGTAGTCGCTATTCAGAAGAATTATTTTTCCATCATGTGATAATCTAACAGTTAAAAACTGAGCTTTATGCTAGATCCAGGAAAGCAGTAGTTTCATTAGTCTAGCTTTTCTCATCATCAACTCACTGAAGCAGAATCTGATGAAGTGAAGCCAAGTTTTCATCTGTTAGGTGGATGGCTTTTTTTAAGTTATAATTTCTTGCTTCTTTTTCATTCCCTTGCTTCTTTCTCTGTATGAACTTCCGAATATGCCACTGCTCTCTTTTCTATCATATCACTCCTTGCTATTTTCTAGTACATGGCAATAGAACATTCTTAAGGTAAAAAATATTACTGTTTGAAAACAATTGGTATTGTGCAGTCATAATACTCTAAGTCTATAAGCTTATAAGGCATTTTGAGTTCCTTGGAAGATAGGAGCTATATAAACCCAGTAAGTACAAGGGAATATAAGAAAAATGAAATTAAAAGTATCATTTTAAGTGTACTTGTATTAAGCACTGTTCTTTAGTACCATTATGCATTATTGATCCTAGAAACCTACAAGTAATCCATTTTAAAAAATTTATTTTGGTTGATAATACACTATTACTCAGCTTAGCAAAGGTTTCAGAGAAAACACCATTTATCCTTTACAAGTTTCATCTGAAGAAAGTTAGAAGAATATAGGTTTCCCCCGCCATCTGAAAGTAGAGTATTCTAATGAAAACTTCTGAAGGCTGAAATGATGTAAAGTGAAGAAGCAATTACCATTAGTTTAAAAGCAAAAATCTTCTTCAAATTTCTTTTGGTTAGTGGAAAACAGGTACTAAAGCTGGTCTTTTGTAAAAGTCAAGTGGCCTAACTCAAACTTTCAAAAAGCATGGAATACCTGTACTTAAAAACTTAAGCACTTGATAAATCTTTCAATTTAAAAAGCTATTAACATGTCCAAAAAATCTTAACTTAGTGGCAAGATTTTAGGATAATATGGCTATTTGCCCCTGGATTGTAAAACTCCACTTTCAATGTAACCATTCAGTTTGCAGCATTTAATATATGTATTGACAGTTTTGCTGTCTCATGTAATTATGGTGACCTATAAGGCACATTTGTTATCTTATAGCCGATAGGTTTTTCTTACAAAATAAGTAGACTTTGAAGCGTATTTGCTAAAATTTTTTAAAGAAAAAGGAGCCACAAAAATTGATACTATCAATAAAAGACAAGATTTTTTTTTCAAAGGCAAAGAAAGTCTTCATGGAAATAAATGAGCAAATCACAAATGGTAAATCCTTTTAAAATATCTTGAATGGCAGCAAATGTGGATCATGCACACCTTAATATTTAAATAGAAATAACTTACATCTTTGTTTTCTGTCTGTTTAATTAAAGTGGATGTAAAAAAGAAAGGTCCAAATGAACTGATTGTTTCCTTAGGATTCTGTTTTCTTCTGTCCCTTCTGGTCTAATGTTCCAATACTGTGCTTAACATTCTTGAGGACATTAGAGGCTTTACAGCTCTAGTTTGGGGCTCCTTTGTATCATTTCTATTTTCCATTTAAAATCTTCCCTAAAGTCTACACAAAAAGACACCATGAGGATGTACAAGGTTAAAAACAGTTAGATATATGCTTTATTCCTGCCCCCAAATCCATTAAATTATCCAGTTTTCAGAGAGCAGCATCATAAAGTGAAGACAAATATTTATTAGATGAGATTCACGTTTCACTTCTACACTTGTGCAAGGATTTTTCACAGTAAAGGAGAGGGAAAGAAGGAAATTATATTTCTAGTAATATATGAAAAATACTTTGACAATGTCTTTAAACTCTTTCAGTAAAACTGTAATTCTACACTTGAAATAATTAGTTTAAGAAAATATATTCTGTATTGTGCAGGCGATCTTGTCTTCTAAATGGAGAAAAACAGCTCTTGGAGGATGTTTTGTACAGCTATTTTTCTGTTCTTATCCTTAGAAACATTTGACTCAAAAATGCAGGCTGCTTTTATTTTGTATTTTATCTTAAAACATTTTAGCAGCTCTAAATCTTTAGTGTCATGGGTTAAAAATATCTATATTTAAAAAAATATTTAATATACGATTCATATAATTTTTACAAAAAAACCACGAATTCTTAGTATTTCAAAATTGGAAGGGCTCTTAGATGTGTCAAGCCCAGTTTCCCATTCTACAAATGAAGAAATTGTTAATTGTAACATATCATATATAACGACAACCAGGACTAGATCTCAGGATTCCAGACTCCGCCTCTAGTGCTCTTTCTTTTCCACATGATGGCATTATTAATAACCTACCTTGAGACCTTTGAAATTCCCATGTTTAATAAAAAGAGGCAATTGCCATGGTTTTGTTTTTGCTTTGCTCTCATTCAGTTTCAGTTGGCTCTAAATTTTATAGTATGCTTCAGATCCCTGAATATGCTTAAATATGTTTGAAATGACTTTGTCATAGCAATCTTATTATGAAGCTCCTCTGAGTCTATAATATGATAGAAAATATTTTGGTAGTTTAATGGTGATAATTCTTTTGAAAAGAAAAATAAAACTCTGGAAAGTTGTGCTAGCTTGTGTAATTCTATCTTAAAAAATGAGTTAGCTCAGCTGGTGAGAACACTAAACAAATGAGACCAAGTTCATGGCCACAAAGTCAGTCATTCCGTCACCAGGTGAGACAGTCAGCTTTGCATGCTCTGCTCTGCCCTCTAAGGCCACACCCACTCCAGGTGCATTGCTATAACCCATCCTCTGAGGGCCTAGACCAAACGGAATCTAAATCAATGCAAAACTATTATCACTCTGGAAAACCAGTGGACTTACCAGCCAAACCTTGGCAGCACAGCTGCTGATGGGCCCGTTCACTTTCTTTACATATATGTAGGACCAAACATGGCAGTCTCTATATCCTCAAATTATAGTATGTATGCCACAGATCACAAAAGTTTTCTCATTTATGTGAATTTTGAGAAAAACCTATGATCAGTATCTTTTAATGTATTACACAGGAAATTAGGTTTGCTTTGCTACTTGAAAATGTGGTTTAAGATTAAAGATAATGATTACTATATCACAAACTTGTATGTAAATGTTCATAAGAACAGGAATGCAGTTTATGTTTAGCTGACATTTTATGATAATAGGGGTTATTTGTGGTTCACAGTTTAATTGTAAGGATACAATTGTTTTCAAGGAAGCAAAAGCTTAAAATATGGCCAGCTATAATAGTTTTTTTGACAAGCAAATATTTAATAATATGTTTTAAAGAACCTGAGGATGCCATCAAGATAGGCTTATTTTAAAATAGAAATTTATAGATTTCCCTACTCCCTTACTCCCATCCCCACAATCTTATTTCTACTACTTTTTGTTTTTTTCCCCCAAAGAGAACCACGATACATAACATTTCAAGGTGACTGCTTGCACACTGGAGAATTAGACTGACTAAAATATTAGGTGGGTCAGTGTACAAATATACATTTCTCTACATGAAGCAGTTTCTCTCAGTTTTACAATACAGTTAGCCAACTGTTAGAAGACTCTATCTTTCAATTAGACACGTTCTGTGGTTATTCTTACAGATCATGGAAAACACAGCTATAAAACTTTTAAAAGACATTTTAAAATTAACTCATGTTTCTTGTAGATTATTTAAAAACACAGGGTTGGGTGGACACCATGAATAGTCTTACCGCTAAGGAAAAAGTGCCTTAATATTGAGATAAACCACCATCTGTTTAAATCACATTGTATCTTGCCTTTTCACTTACAATGCTGAGAACATTCTCCAGTATCATTAAAAACTTTTAATATCTGGTTTTAAAGTACTGCAGACAATCACATATTTTACACATATAGGGTGTTTCTTACAATTTTACCTAATGTTCTAATACCTGTGTTTCTGTATCTCTCATTTTCTCCTTAAAGTAGATCTTTGAAGGAGAATTACTGCATCAGAGGGTATAATCTATTTTCTAACCTCTATTTAAATTAGGAATATTAAATGTACATCATCAGTTAACTATATGTTTTAGGAGTCTCACATCATACTTTTTACAGAGTACTGAATAGTCTGTGGACAGGATCATGAACAGAAAGAAACTTTGATTAAGTTGCTAATTTACTTGTCACTGTTTTTAATTCACAGATGTCTACGCATTGTTAAAATAACAAAATTAGAGGATAGCTAACCCCATAACTCAGGAGGGAGGGAGAGAAACAGAGAGAAGTGGGGAGAGAGAGTCAGACTCAATTATGATTCACCACTGATGTTTGATTGATGACTGAAATGTACTACGTCTCATTTAATTGATTTTGAACTTGTGTAAGTAAGCCAGTATGGCTCCCTTTGAGGCTTATAGCATGTGGCCATAAAGGGAGGTGAAAGTTCCATTGAATGCCTTATTCAAGAGTCTGTGGTATGTATGTTGAGGAGTGAAATGCATGCCTTGGTTACCATCAATAATGTCTGGAATTCTGAAGAGGTTAAGAAGTGTCTTGGTGAGGCTTTTTATTTTGGCTTTAGTATGGGCAGACCTGTGTGACCTTGATTCATATTTTGGGTATCTGCGAGGCAAGAAATCCCCAGTTTTTTAGCCAAAAGAAGGTGACCTTGGAAGACTAATCTGGCAGCAATGAATGGAGAGACAGGAAACAAGTGACTTATTTCAGTAGTTAAGGTAAGAAGGTCTTTTATAGTGGTTTTTAATTCACAAATTAAAAAGTTTCCTTGGTCAAGTTTAAAGATGCTGTTACTCTTTTTCGAGTCAGTTCTTAGGACCAGTTGGTTTTAATTTCTGAATGAATGAATTGAGAAGAATGGCTGTATCCAATAACCAGAGCGTTCCCTACTCTATTCCTTCTTGTTCTCTTCCATCCTTTGATAGATGCTCTAATGAGAAATGAATTCACCAGAGAGATTGCTTGAACAAATCTGCAATCTTAATAATTTAATACTGGCTAACCGAGTTAAACATTGGATGATATTATGTTCTAATAGTCCTTACAGTAAGTTGATTACATATAGGTAAGGTAGTTTTAATTAGCTTTATACTACATGCTGCAGAGACATTTTGTATTACTTCAGGAAGTGCTTCTTATTTAAGAAGTGACATATTTCATAATTCCTTATGTCATAGTTATATACTCTAGGCCCCATTCTTAGTACTTTATTAATAAGTAATTTTTTTCTCTTAATGGGACAATGTGGTAGGAACTATTTCATAGATGAGGAAACTGAGGC