Transcript asmbl_266003

Sequence
Transcript Sequence for observation asmbl_266003 of TGE0002382:
GGGCGTTGTAGTCTGGCCGGAACCTGTTTGTGACTACAAGTCCCGTGACTCCGCCCCTCTTCCCCTCCTAGTCCGCAGTCCTGTCCGCGGCCTCATCTGGGCTTCTCTGGCCCGGGGCACGCTGGTCCGGCGAGTCAGCGGTCTCTTTCCTGGGTACCAGAGACGGAAGCCGGAGGGGCACGGGGAGGAGCTTTGCGCGCGGGGTGAACGCTCGCCTTACGTGCTCGTTCGCCTCGCGACCGCTGCGCGCGAACCCGGTGTCCCCGCGGCGGCGTCGGTGGAACGCGGAGGGGGCGGAGGGAGCCCGCGGCGGCGGCAACAGCGAAATGGCGGAGACGGTGGCGGACACCCGGCGGCTGATCACCAAGCCGCAGAATCTGAATGACGCCTACGGGCCGCCCAGCAACTTCCTCGAGATTGATGTGAGCAACCCGCAGACGGTGGGGGTCGGCAGGGGCCGCTTCACCACCTATGAGATCAGGGTCAAGACAAATCTGCCTATTTTCAAGCTGAAGGAATCTACTGTTAGAAGAAGATACAGTGACTTTGAATGGCTACGAAGTGAATTAGAAAGAGAGAGCAAGGTTGTGGTTCCCCCGCTCCCTGGGAAAGCATTTTTGCGTCAACTCCCTTTTAGAGGAGATGATGGAATATTTGATGACAATTTTATTGAAGAAAGGAAGCAAGGGCTGGAGCAGTTTATAAACAAGGTCGCTGGTCATCCTTTGGCACAGAATGAACGTTGTCTTCACATGTTTTTACAGGATGAAATAATAGATAAAAGCTATACTCCATCTAAAATAAGGCATGCTTGAAATTTGGCAAGAAGAGGCAAAAAAAACTTTCCGTGACTATTATTGATTCATATGCACCAGTGAAGAAGTTCTAACTAACTTTTAGCATGCTGCACAGAAACTGGTATAACATGCCTTCCATATACTAACACTCATATGCTCTGTTTTGTTTTGGCAGTTGACAAGAATTTAATTTGCTTTAGTGAAAATCCCTCATTCTAGCCTTTCTATATAATAGCTCTTCCTTGCTCTTTTAAGGTGGTATACACGATAGCTTCACAAACCTGTTACCAGTATAATCTGCAGTGTCCTAACTAAAGCTACTGACTTGGTCTTATCTGCACAGTTTTTGTGTCATGTTTGCTTCTTGAATCTGATAAACTAGAATATTTCTCTTATCCCCTTTTTAATATACGATGTCACTTGACCTAATTTATGTGTAGGAGCACTACACCATCCGTTTCCAGCACCCTACATGTAAGATACACACTTGTGTGCAGAAAGTATATCCCTTCAGGCTTGTAATACCCTTCACATGGAAGATCAGTGAGGGAAATCTTTATATTCTGTATAAAAACAAAATCAAATTTATATACTAAAATCATTTGTCTAAAAAATTTAAGTTGTTTTCAAATAAAAATAAAAATGCATTTCTGATATGCACTG