Transcript asmbl_262736

Sequence
Transcript Sequence for observation asmbl_262736 of TGE0007598:
NNNNNNNNCAAACTGCAAACCCAGCGCGGGTGACATCCAGCAGGGCCAAGCCGGCCCCGGCCTGCCCAGGGGGCCTCGGTGCCAGCTGGAGGGGCTGGGTACTGCGCCCTGCTGGGCCAGCGCTCTGGGGGCGGGGTTCTGCTCCGCCCTCCCTCGGCGCGGGCACGCGGACAGGCAGGGTAGGGCTAGGGCCGGGCTCTTCTGGGCCAAGGATCAAGGCTCCCATGCCTTCCAGTCTTCCCGACTGGGACTCGGAACAGGGCGCAGTAGCACACAGCGAGGAACCGCACCACCTCGGCTGGAGATGGGACCTATCGTGACCCCGCCCAGGGCGGAGTTATCTGGATCTGAGACCCGCCCTCAACATTGAAGTCTCTGGGATGCAATAGTTCGGGGCGGAAGTTAGAAAGCCCCGAGAGCGAGGCGACGGAAGTGGCCCCTTTACTGTTTGTCCGTGCGCAGGCGTTATTCTATTCTCTTGCTGCTGCTCTTCAGGCGCTTCTTTTCCCTCTCTTCTCTCTTCTCCACGCGAGGGGGTGCGCGTACCCTTAGTCGTGGTCGCGCACTCAGCCCCTGTGCTACTCTCGTGGCACTTTCATCATGGCGGGCATCCTGTTTGAGGATATTTTTGATGTAAAAGACATTGACCCGGAGGGCAAGAAGTTTGACCGAGTGTCTCGACTGCATTGTGAGAGCGAATCTTTCAAGATGGACCTTATCTTAGATGTAAACATTCAGATTTACCCTGTAGACTTGGGTGACAAGTTCCGGTTGGTCATAGCCAGTACCTTGTATGAAGATGGTACCCTGGATGATGGTGAATACAACCCCACAGATGACAGACCTTCCAGGGCTGACCAATTTGAGTATGTAATGTATGGGAAAGTGTACAGGATTGAGGGAGACGAAACTTCTACTGAAGCAGCAACACGTCTCTCTGCCTACGTCTCGTATGGGGGCCTGCTCATGAGGTTGCAGGGTGATGCCAATAACCTGCATGGATTTGAAGTGGATTCCAGAGTTTATCTGCTGATGAAGAAACTGGCCTTCTGAACCACCTGGGAAGCCAATCTTGCTGCTTAGTCACTTAGGTCATGGACATTCATTCAAGTCTGAGCAGCAGTTGCTGTTGTTCACCTGTCTAAGAGGGGCTGGATTTGTGTTGATTGTGCCGTGCATCTTTAGGTGGTGTCTGAACTCAATGGGAAGTTGACTTGCTTGTGAAAGACCCAGTGGGAGGGCTTAAAAGGAATAAGAAGTTGTTGTGTGTATATGATTTTTTAAATTAAACTTTACTTTCTCAGACTTTCTTCCCTTAAAATATATATTTTTTTCTGTTTACTTTAAAA