Transcript asmbl_257957

Sequence
Transcript Sequence for observation asmbl_257957 of TGE0007458:
GTAAAAGTGTTGCGCCGTTGGTGATTCCGGAAGAAACCAGAGTGCGGCGTGAACATGGGAAAGCAAAAGAAAACAAGGAAGTATGCGACCATGAAGCGAATGCTTAGTCTCAGAGATCAGAGGCTTAAAGAAAAGGATAGATTAAAACCTAAAAAGAAAGAAAAGAAAGATCCCAGTGCACTCAAGGAAAGAGAAGTCCCCCAACACCCTTCTTGCCTATTCTTCCAATATAACACACAGCTGGGGCCCCCTTACCACATCCTGGTTGATACCAACTTTATCAACTTTTCCATTAAAGCCAAACTGGACTTAGTACAGTCAATGATGGACTGTCTGTATGCCAAGTGTATCCCTTGTATAACTGACTGTGTAATGGCTGAAATTGAGAAATTGGGGCAGAAGTATCGAGTGGCTCTAAGGATTGCCAAGGATCCAAGATTCGAACGATTACCATGCACACACAAAGGAACCTATGCAGATGACTGCTTAGTACAGAGAGTAACTCAGCACAAGTGTTACATTGTGGCCACGGTTGACCGAGACCTTAAACGAAGAATCAGAAAGATCCCTGGAGTTCCCATCATGTATATTTCTAACCATAGGTACAACATTGAGCGGATGCCCGATGATTATGGAGCCCCTAGGTTCTAATTCTTAAAAGATAAAATTCATCTGCTTTCCTTCAACCAACTTTCTCTGTTGCCAGTTTATTAAACATGCTACAGCATGAATTATTCTACTCAGACATTTGCTCTGTTATAAGCTGAGTATGGTTAAATACACTCAGTTTTTGATATTTGAAAATGATATTTTTGTATCATTTAAAAATTTGTTGCATTTTTTTATAGATCAGATGACTGCTCACAAATTTAATGGTTGTTTTATATTGATTTACTCAAATATTTATTAAGGTTATACTAGGTACTTAATAAGATAGGGTCCTCAAGACACTCATAGTGGGAAAGAGGAGCATGTAGGTGAATAAATATAGTAAAATAATAATGCTAAGATAAAAGTATGAGGAGTAGACACATAAAAAAGATGATTTTTTTCTATTCAGTTGGGGTGGGAAGGGAGGAAAAGCTAAAGGTAGCAATGTTTAAGTTCATCTTTTTTTAAAATTTATTGGGGTGACACTGGTTAATAAAATTATATAGGTTTCAAGTGTACAGTTTTATAATACATCATCTTTGAGTTAATCTTTAAAAATAAATAGGTGCTTGCCCAGTAAATGAGATAAAGGAAATGAGGCACAGGAAGCATCTGAACAAAGCATGGACATAGATATTACATGAAATGAATGTATCTGGTCTGTTCAGACAACTGCCAGAAGATTTTTATAACTAGAACATGGGAAAGAGGTCTATACTCATGTCTGAGACTCCAAAGGTAAGAGGTGGGAGGGAGGGAACCTTATATGACATGCTAAATGGATCGGTCTTGATCCTGAGGTCAATAGGGAGTTATTAAAATTTAATTAGGGTGATAACATGATCAGTTTAGATATTTTAAATGATCACAAATTAGTGTAGGAATAGACAAATAGATCATTGAAACAGTAGAAAGTCCATAAAGAGATCTATATATTTATGGCAGTTTGGTGTATTTTAAAGGTGGTATTTCAAATCTGTGGGAAAAGGAAGTTGTTTTAGAAAAACCAAATAGTGTGGAGGCTACTAGGATTAGAATCTTGATTTTACCATTTAGTGTATGTATGAATTGGACAGAACTACATAACCATTTGGTACCCTCCTTGTTTCCTCTTTAAAATGTTTTGTTTAATCCTAAAAACAACTTTGATAAAATGAGATTAAATTGAGCAGTACCTGAAACAAGTAAGTGGTATTCAATAAGTGTTAGTAATTATTTTATTATAATGGCAAGTTGGCTATCCTTTTGATAAAAACTTTCAGATTCCTACTTCATATCCTTCATGAGAATATATTTCAAGTGGACTAAAGTTCTAAACTTTTTTTAAGCTATGGAAGTATTAGGAAAAATAAAACACGAAAAATATGTATAATCTTTGGGTAGAATTCTTAAATAAGATGAAGAATGTTAAAGCCATAAAAGAAAAGATTGATTAGTATGACTATGTTAAAATTATAGATTTCTGTGCAAAGCATCTCCTCCAAATATTGACAGGTGACTGACCGGAAGATTTTCCAAGAGTGTGAGGAATTAGGTAGTCATGTGGTGCTGACAAAAGTTTAACCATTTTAGACAGCAGTTGGGCAAGAGCCATTAAAATAAAAATTGCAGATACCCTGTGAGCCCCATT