Transcript asmbl_257930

Sequence
Transcript Sequence for observation asmbl_257930 of TGE0007455:
CCAGTACCGAAGAGACTGCTCTTGCGAGGAGGTGGTGGAGATAAGCCATCCAGCAGTTCGGGACATGGAGTTTTTGCATTGACTGCGGTTTCCAAAGCCTGATGAAATGAAAAGAGCAGTGGTCTAAGATGCCAAAGACTGGAAGCTTGTTCCAGAAAGCTCTTGGCCGCAGTGCATGCCGGGCAAGAGGAAGACCTCCAGAAGCGCCCCGCGCAGCGCGGCTGTGTTTGCGTTGCGGCCTGTGCGAGTAGTCGCTTCGGAACCAGTCTCCCGGCGAGCGGCGCGCAGAAACCTCGAACCGGTGGAGCCCACTCGTAACCTGGAGCCCATAAGGCCGCGAAGACAGTACCTTTTCCTTAGCGGCGGACTGCTGCAGTAAGAATGTCTTTCCCCCCTCATTTGAATCGCCCTCCCATGGGAATCCCAGCACTCCCACCAGGGATCCCACCCCCACAGTTTCCTGGCTTTCCTCCACCTGTACCTCCAGGAACCCCAATGATTCCTGTACCAATGAGCATTATGGCTCCTGCTCCAACTGTCTTAGTACCCACTGTGTCCATGGTTGGAAAGCATTTGGGAGCAAGAAAAGATCATCCAGGCCTAAAGACTAAAGAAAATGATGAAAATTGTGGTCCCACTACTACGGTTTTTGTTGGCAACATTTCTGAGAAAGCCTCAGACATGCTTATAAGACAGCTCCTTGCTAAATGTGGCTTGGTTTTAAGCTGGAAGAGAGTACAAGGTGCATCTGGAAAACTTCAAGCCTTCGGATTCTGTGAGTATAAGGAGCCTGAATCTACCCTCCGTGCACTCAGGTTATTGCATGACCTACAGATTGGAGAGAAAAAGCTACTTGTTAAAGTTGATGCAAAGACAAAGGCACAACTGGATGAATGGAAAGCAAAGAAGAAAGCTTCTAATGGGAATGCCAGGCCAGAAACTGTCACTAATGATGATGAAGAAGCCTTAGATGAAGAAACTAAGAGAAGAGATCAAATGATCAAAGGGGCCATTGAAGTTTTAATACGAGAATACTCCAGCGAGCTCAATGCCCCTTCACAAGAATCTGACTCTCATCCCAGGAAGAAGAAAAAGGAAAAGAAGGAGGACATTTTCCGCAGATTTCCGGTGGCACCACTGATCCCTTATCCGCTCATCACTAAGGAGGATATAAATGCTATAGAAATGGAAGAAGACAAAAGAGACCTGATATCCCGAGAAATCAGCAAATTCAGAGACACACACAAGAAACTGGAAGAAGAGAAAGGCAAAAAAGAAAAAGAAAGACAGGAAATTGAGAAAGAACGGAGAGAAAGAGAGAGGGAGCGTGAAAGGGAACGAGAAAGGCGAGAACGGGAACGAGAAAGAAAAACGTGAACGAGAAGGAGAAGGAACGGGAGCGGGAACGAGAACGGGATAGGGATCGTGACCGGACAAAGGAGAGAGATCGAGATCGGGATCGAGAGAGAGATCGGGACCGCGATCGTGAGAGGAGCTCAGATCGAAATAAGGATCGGAGTCGATCTAGAGAAAAGAGCAGAGATCGTGAAAGGGAACGAGAGCGAGAAAGAGAAAGAGAGCGAGAACGAGAACGAGAGAGAGAACGTGAGCGAGAGAGAGAGCGAGAAAGGGAACGAGAGCGTGAGAGAGAGAAAGACAAGAAGAGAGACCGAGAAGAGGATGAAGAAGATGCATATGAACGAAGAAAACTTGAAAGAAAACTTCGAGAGAAAGAAGCTGCTTATCAAGAGCGCCTTAAGAATTGGGAAATTAGAGAACGGAAGAAAACCCGGGAGTATGAGAAAGAGGCTGAAAGAGAAGAAGAAAGAAGAAGAGAAATGGCAAAAGAAGCTAAACGACTAAAAGAATTCTTAGAGGATTATGATGATGATAGAGATGATCCCAAATATTACAGAGGAAGTGCTCTTCAGAAAAGATTGCGTGATAGGGAAAAGGAAATGGAAGCAGATGAACGGGATAGGAAAAGAGAGAAGGAAGAGCTAGAGGAAATCAGGCAGCGCCTTCTGGCAGAAGGGCACCCGGATCCAGATGCAGAGCTCCAGAGGATGGAACAAGAGGCTGAGAGGCGCAGACAACCACAAATAAAGCAAGAACCAGAATCTGAGGAAGAAGAAGAAGAAAAACAAGAAAAAGAGGAAAAACGAGAAGAACCCATGGAAGAGGAAGAAGAGCCAGAGCAGAAACCCTGTCTCAAACCAACTCTGAGGCCCATCAGTTCTGCTCCATCTGTTTCCTCTGCCAGTGGCAATGCAACCCCCAACACTCCTGGGGATGAGTCTCCCTGTGGTATTATTATTCCTCACGAAAATTCGCCAGATCAACAACAACCTGAGGAGCATAGGCCAAAAATAGGACTAAGTCTTAAACTGGGTGCTTCCAATAGTCCTGGTCAGCCTAATTCTGTGAAGAGAAAGAAACTCCCCGTAGATAGTGTCTTTAACAAATTTGAGGATGAAGACAGTGATGATGTACCCCGAAAAAGGAAACTGGTTCCCTTGGATTATGGTGAAGATGATAAAAATGCTGCCAAAGGCACTGTAAACACTGAAGAAAAGCGCAAACATATTAAGAGTCTCATTGAGAAAATCCCCACAGCCAAACCAGAGCTCTTTGCATATCCCCTGGATTGGTCTATTGTGGATTCTATATTGATGGAACGACGAATTAGACCATGGATTAATAAGAAAATTATAGAATACATAGGTGAAGAAGAAGCTACATTAGTTGATTTTGTTTGTTCTAAGGTTATGGCTCATAGTTCACCTCAGAGCATTTTAGATGATGTTGCCATGGTACTTGATGAAGAAGCAGAAGTTTTTATAGTCAAAATGTGGAGATTATTGATATATGAAACAGAAGCCAAGAAAATTGGTCTTGTGAAGTAAAACTCTCTTTACACTTAAGAGTTCCATTTCAGATACCATCTTTCCCATCCTTCAAAGGACTTTGAATTTTTCTTTGTCTTCAAAGACATTTGCAAGATCTGTAATTTTTTTTTAATGTAGAAAATGTGAATTTTTTTTGTCCTCCAATTCGTTGATGCCTTGTGTACTCTCTTGGTTGTAAAGACATCTGAATCCTACTTTGGTTCTCTTTATACTCACCAGGTACAAATTACTGGTATGTTTTATAAGCCGCAGCTACTGTACACAGCCTATCTGATATAATCTTGTTCTGCTGATTTGTTCCTTGTAAATATTAAAATGACTCCCCAATTCTTTTGCAGAATTGCACTTAATATTGAACTGTACTGTAAAGGAACCAACACGAACAATTTTAATTGAAAGAATACCAGTCCTTCCTTCCCTATTTGATCAGAATTGGCAAGCTTTCATGAAGGCATGAAATTAATTTTTGAAATTAGAGTGCGAAAATTAGCAGACCATCCATTCCTACTGTATCTGTATGAATGTGTTTGTGTGAATGTATATATAAAAGTGTTACTTTGCCCTGATTTGCTTTGGAGGGCTCCCGTAAACATTTCCTAACTGAAGAATAGAATCGTAAAGGAAACGTGGTGTTGTGCCAACCCAAATGTCTGGGATAATTAGGTTATTAGTCTCCCAGAGCATGGTATTCTTTTCTGGCAAGCAACAGTCTGTTGAATAGCATGGGGTTCTCCTGTTGATAGCTGGCTGCTTCAGCCTCTCTTTTTAAGGGACTGTGAATCACTGATCCCCTGCCCCTCAATTTCATTGTGCAGAGATGAGTCAGATCCTTAGATTCTGGAGAGCTTTATTTAATGCATTTTTGCACTAATTGGTCTTTAGCTTAATTTTGGTGTACCCCTTTTGTTGGGAAAAAAATGGAAAAGCATAAATGAGGGAAAAAAAACTTGAGAAACAAAAGATAAAATTAGGCCATTTGACAGACTAGGAAAATTTGACAAAATATACTAGGAATTCAGCATGGCATTTTACGTTTACATCTTATTTCTAAGGATAAAGTAAATCATTTAAGGCAGTTACCACTAATTTTTTGTTTTTGTTTTGATAAAGGGTTTATAGCTTGTGCTTGTGTATATACACACACACTTTGTTTACCTCTGCTCATCAAAGTTTGAAAATATACTGATGTTGTTAGAGACATACATTTCTTTATTGTAGATCAGAACTTCACCAGGGAGCAAAATTACCTGAAAACGTAACGAGTTTTAAACAGTTCTTAACAGAGTAGGTGTGGCTATTACCATGTCTGAGTATTTATTTAAAAGAAAAATAAAGATTTGGTGGCGGTGGGGGGATGTTAAAAAGCATAACTGAGCTTGAGTTATTAGATTTTTTTACATCTTAAAGAGGACATTTGAAAACACTGTTCTTAATATTGGACCATGACATGGTTCTATTATGTAAATATTTCAAATATTAAAAATGTATATATTTGATCTTGGGGACTCATTCTTTCAGAGTCTTATTAAATAAATGGCATCATGCTGTAATTGTGCAGTGCATACTAGAAACTTAACTTGAAAATATGGGCTAAATTAATTTTTATGAATATTAGTGACTGAAGGGCAAAGAGGATATTACCTAATTTTAGATTACTCTATATGTCTATGGAGATATCTCCTTTTAGTGTTATAATATAAATTCTGGTTTCTCAAGGGAAAATTTCAGAAACATGCTCCTTGCCATTTACAAATTAATTTACTAGCCTTTTTTCAGATTCATCCTCACCCCAACACCTTGTTTGAGCAGTTTATCATGTCTGTCTTCTCTTACCATATTACTACTTCTAAAGCATGTTAGGTTGTTTTTGTTTAACCAAAATTAGCATGAAGGTTTATTCAGATGGATTTAATTTCCCTTGCTTTGTTCTCTTCTGCTCTTTCACAGTATTTATCTTATAGGGCGGGTATCTGAAACCCTTGAGGATATACATCGTCTACTGCATAACACTTCCAGTGAGATTTGCCTCAGGATCCCAAGTTCATACATTAACATTTCTGCAGCAGAGCGGGAATGATCAGTCACTGGGTTAAAGACCATTACATTAGTAGCTTAATGTCAGTTCAAGTCAGGTTTTGCCACTAACCTTAAACTTTAAGGTTTTCAGAGTTTGTTTTTCAGATTTGCATATAAAGAATTAGACATGTATAAACTGGCATATTCTAGTGTTTGGGAGAATACACATAAGAAAATTTCTACTAAGTTGCATGAACTTTCTGGGTTGCAGTCATCATTTGCCCATAGCCTAATTTCAGTTTTGGGAACCTTAGATAATCCATATTACCCATTCAAGTTATAAAATTATACAAAAATTTGGCAGAAAACCAATATGCTTTTTCGTCATTTGACCCTCTAAATAATTTAAAATATGTACATCTGTTTACAGGAGGAAAGATAAGTTATTTGAAGTAGTTTCTTTAATCAAACTTGAATGCCTGTTTAAATCACCTGATGGAATCTTGTTAGAATACAAACTGATTTAGTAGGGCCAGGATGGGGCCTTAGGATGATGATGATGCCAGTGCTAACTGATCCAAGGACTACGCTTTGATTAGCAGTTTAAGGTACCTACTCAGTACTAGTATTTTATCCTAAAAGACTACATAAATGCTGCTTAATTTTCAAGTAGATTTTAAAGGGAAAAACATTTTTGAGGCAAACAGATACTTTGTTCATGAATATAAAATAATCTTCCAAAAATGCCTGAGAACTCAATATTATAGGCTTTATTCCTAGCCAGCCCCAGAACATTTTCTCCTTAGAGAACTTTATGTTGTTACTTATTCTGAATCTTACAGTGCTTCCTGGTAAACCTATGTAATAGTAGAGGCTAATGGTTTTGTGGAGAGTTGCTGTTTCAGGTACTCATCAGGCACAAATACTAGGTATGGTGGAAAAATTGAAAAAACAGCTTGAGAGTCAAACTGGACTAAACACTGTTATTTTCTTCTTTCATATGAAGTAAAAAACTTATGCAAATAAATGTAAGTAGGTATACAATGTGTATATGAGGCTTATTTACCCAACTCTAAGACTGCAGAATGGTTTGGTGTCAAAATGGTTACAAATTTGTTTAGGTTATATTTCATCTTTTTATTAACAGTATGAATTGAGAAATAGTTTTTGTTCAGCAAAAGATGGTGAATTTGACTTGTGAAAGCCACTGGTTATAAAGGATATGAGAAGGAATCCCAAATAGCCAAACAGTCTAGATGTCAGGAAGAAAATAGGAAAATTCATATGTACGTTTCAAACTGAGGAACTATTAACATACTGTAGATCAGAGTGAACTTATTTTTTATAAACGTGGATTTTTTTTTGAAATGTACTTATATTAACATTGAAATACTTATTTGCATTTGCTTACATTTTCATCTTAACTGACTGATCATTACCTTTCATTCTATTACTTAACTCATGTGCCAAATTAGGAATGGCAATCTAACATGCCCAAGAAGATAATTTCCATAAACAAAAATGAATAAAAATTCTCAAGCCATGTTTGAATTAAATGACACTTCCAAGTCTGTTTACTCTGCCACATTAAATATTAGTTGGATCGATGACTTGGATCATTGTGCGCCAGATACTTAGGTTTGGAGATTACAAAAATAAGACAGATTTTCAGCTCTATGGAAGTTCACCATTTAGGAAGACTGGTTCTTAAATTTGGAGTCCAAGAATCCCAGCTGGCATTTGTTTAAAATACAGTTTCCCGCCCACCAGAAGTTTTGATTCATTAG