Transcript asmbl_250595

Sequence
Transcript Sequence for observation asmbl_250595 of TGE0073105:
CGGAGCGGACGTAGGGTTGTCGCCATTGTGTGAAAATTCTCCCGGCATGGCCGGAGTATTTCCTTACCGAGGGCCGGGTAACCCGGTGCCCGGCCCTCTAGCCCCGCTGCCGGACTACATGTCGGAGGAGAAGCTGCAGGAGAAAGCCCGAAAATGGCAGCAGTTGCAGGCCAAGCGCTATGCGGAAAAGCGGAAGTTTGGATTTGTGGATGCTCAGAAGGAAGACATGCCCCCAGAACATGTTAGGAAGATCATTCGAGACCATGGAGACATGACCAACAGGAAGTTTCGCCATGACAAAAGGGTCTACTTGGGTGCCCTAAAGTATATGCCCCATGCAGTCCTCAAACTCCTGGAGAACATGCCTATGCCTTGGGAGCAGATTCGGGATGTACCTGTGCTGTACCACATCACCGGAGCTATTTCCTTTGTCAATGAGATTCCCTGGGTCATTGAGCCTGTCTACATCTCTCAGTGGGGATCAATGTGGATTATGATGCGGCGAGAAAAAAGAGATAGGAGGCATTTCAAGAGGATGCGTTTCCCCCCTTTTGATGATGAGGAGCCGCCTTTGGACTATGCTGATAACATCCTAGATGTTGAGCCACTGGAGGCCATTCAGCTAGAGCTGGACCCTGAGGAGGATGCTCCTGTGTTGGACTGGTTCTATGACCACCAGCCATTGAGGGACAGCAGAAAGTATGTGAATGGCTCCACTTACCAGCGCTGGCAGTTCACATTGCCCATGATGTCCACACTCTACCGCCTAGCCAATCAGCTCCTGACAGACTTGGTGGATGACAACTACTTCTATCTGTTTGATCTGAAGGCCTTCTTTACTTCTAAGGCGCTCAATATGGCCATTCCTGGAGGCCCCAAATTTGAACCTCTTGTTCGAGATATCAACCTACAAGATGAAGACTGGAATGAATTCAATGATATTAACAAGATCATCATTCGGCAGCCTATCCGCACTGAATACAAGATTGCTTTTCCTTACTTGTATAACAACCTTCCACACCACGTGCACCTTACCTGGTACCACACTCCTAATGTTGTATTCATCAAAACTGAGGATCCTGATTTGCCAGCTTTCTACTTTGATCCTTTGATCAACCCAATTTCCCATAGGCACTCTGTCAAGAGCCAGGAACCATTGCCAGATGATGATGAAGAGTTTGAGCTCCCAGAGTTTGTGGAGCCCTTCCTGAAGGACACACCCCTTTACACAGATAATACAGCAAATGGCATTGCCCTGCTGTGGGCCCCACGGCCCTTCAACTTACGCTCTGGTCGCACCCGCCGGGCCCTGGACATCCCCCTTGTCAAGAACTGGTATCGGGAGCACTGTCCTGCTGGACAGCCTGTGAAAGTGAGGGTCTCCTACCAGAAGCTGCTTAAGTACTATGTGCTTAATGCCCTGAAGCACCGGCCCCCTAAAGCCCAAAAGAAGAGGTATCTGTTCCGCTCCTTCAAAGCCACCAAATTCTTTCAGTCCACAAAGCTGGACTGGGTGGAGGTGGGATTACAGGTTTGCCGCCAGGGCTACAACATGCTTAACCTTCTCATTCACCGTAAAAACCTCAACTATCTGCACCTGGATTATAACTTCAACCTCAAGCCTGTCAAGACACTTACCACCAAGGAAAGAAAGAAATCTCGTTTTGGGAATGCTTTCCATCTGTGTCGAGAAGTTCTGCGTTTAACGAAGCTGGTGGTGGACAGTCATGTGCAGTACCGATTAGGCAATGTGGATGCCTTCCAGCTGGCAGATGGATTGCAATATATCTTTGCCCATGTGGGGCAGCTGACAGGCATGTACCGGTACAAATACAAGCTAATGCGGCAGATTCGCATGTGCAAGGACCTGAAGCATCTCATCTATTACCGCTTCAACACGGGCCCTGTAGGGAAGGGCCCTGGCTGTGGCTTCTGGGCTGCTGGCTGGAGAGTATGGCTGTTTTTCATGCGTGGCATCACCCCTTTGCTGGAGCGATGGCTGGGCAACCTCTTGGCCCGGCAGTTTGAAGGCCGACACTCGAAGGGGGTGGCGAAGACCGTAACAAAGCAACGAGTAGAGTCACATTTTGACCTTGAGCTTCGAGCAGCTGTGATGCATGACATTCTGGACATGATGCCTGAGGGGATCAAACAGAACAAGGCCCGGACAATCTTGCAGCACCTCAGTGAAGCCTGGCGCTGCTGGAAGGCCAACATTCCCTGGAAGGTCCCTGGGCTGCCAACGCCCATAGAGAATATGATCCTTCGATATGTAAAGGCCAAGGCTGACTGGTGGACCAACACTGCCCACTACAACCGAGAACGGATCCGCCGTGGGGCCACTGTGGACAAGACTGTTTGCAAAAAGAACCTGGGCCGCCTCACCCGGCTCTACTTGAAGGCAGAACAGGAGCGGCAGCACAACTACCTGAAGGATGGGCCTTACATCACAGCAGAGGAAGCGGTGGCAGTGTATACCACCACTGTGCATTGGTTGGAAAGCCGTAGGTTCTCACCCATTCCATTCCCCCCGCTCTCCTACAAGCATGACACCAAGTTGCTTATCTTGGCCTTGGAGCGGCTCAAGGAAGCTTACAGTGTGAAGTCTCGGTTAAACCAGTCCCAGAGAGAGGAGCTAGGCCTGATTGAGCAAGCCTATGACAACCCCCACGAGGCATTGTCCCGCATCAAGCGTCACCTCCTCACACAGAGAGCCTTTAAAGAAGTAGGCATTGAGTTCATGGATCTCTACAGCCACCTGGTGCCAGTGTATGATGTGGAGCCACTAGAGAAGATAACTGATGCCTACTTGGACCAGTACCTGTGGTATGAAGCTGACAAGCGACGCCTTTTCCCACCCTGGATCAAGCCTGCTGACACAGAACCACCTCCTCTGCTTGTTTATAAGTGGTGCCAAGGCATCAATAACCTGCAGGACGTGTGGGAGACAAGTGAGGGTGAATGCAATGTTATGCTGGAGTCACGTTTTGAGAAGATGTATGAAAAGATCGACTTGACCCTGCTTAATAGGCTGCTGCGACTCATTGTAGACCATAACATAGCTGACTACATGACAGCCAAGAACAATGTTGTCATCAACTATAAGGACATGAACCATACAAATTCATATGGGATCATCAGAGGCCTGCAGTTTGCCTCATTCATCGTGCAATACTATGGCCTGGTGATGGATTTGCTTGTGTTGGGATTACACCGAGCCAGTGAGATGGCTGGGCCGCCTCAGATGCCAAATGACTTTCTCAGTTTCCAGGACATAGCCACCGAAGCTGCCCACCCCATTCGTCTCTTCTGCAGATACATTGATCGCATCCATATTTTCTTCAGGTTCACAGCAGATGAGGCTCGAGACCTGATCCAGCGTTACCTGACAGAGCACCCTGACCCCAACAATGAAAACATCGTTGGCTATAATAACAAGAAATGCTGGCCCAGAGATGCCCGCATGCGCCTCATGAAGCATGATGTCAACTTGGGTCGGGCAGTGTTCTGGGACATCAAGAACCGTCTGCCAAGGTCAGTGACTACAGTTCAGTGGGAGAACAGCTTCGTGTCTGTGTACAGTAAGGACAACCCTAATCTGCTGTTCAACATGTGTGGCTTTGAGTGTCGTATCTTGCCTAAATGCCGCACCAGCTATGAGGAGTTCACCCACAAGGATGGAGTCTGGAACCTACAGAATGAGGTTACTAAGGAACGGACAGCCCAGTGTTTTCTGCGTGTGGATGATGAGTCAATGCAGCGTTTCCATAACCGCGTGCGTCAAATTCTGATGGCCTCTGGTTCCACCACCTTCACCAAGATTGTGAATAAGTGGAACACAGCTCTTATTGGCCTTATGACATACTTTCGGGAGGCTGTGGTGAACACCCAGGAGCTCCTGGACTTGCTGGTGAAGTGTGAGAACAAGATCCAGACACGTATCAAGATTGGCCTCAACTCCAAGATGCCAAGTCGGTTCCCCCCTGTTGTGTTCTATACCCCTAAGGAGTTGGGTGGACTCGGCATGCTCTCAATGGGCCATGTGCTTATCCCTCAGTCTGACCTCAGGTGGTCCAAGCAGACAGATGTAGGTATCACACACTTTCGTTCAGGAATGAGCCATGAAGAAGACCAGCTGATTCCCAACTTGTACCGCTACATACAGCCATGGGAGAGTGAGTTCATTGATTCTCAGCGAGTCTGGGCTGAGTATGCACTCAAGAGACAAGAGGCCATTGCTCAGAACAGACGACTGACCTTAGAAGATCTAGAAGATTCATGGGATCGTGGCATTCCTCGAATCAACACCCTCTTCCAGAAGGACCGGCACACACTGGCTTATGATAAGGGCTGGCGTGTTCGAACTGACTTTAAGCAGTACCAGGTTTTGAAGCAGAACCCTTTCTGGTGGACACACCAGCGGCATGATGGGAAGCTCTGGAACCTAAACAATTACCGTACAGACATGATCCAGGCCCTGGGTGGTGTGGAAGGCATCCTGGAGCACACACTCTTCAAAGGCACTTACTTTCCTACCTGGGAGGGGCTTTTCTGGGAGAAGGCCAGTGGTTTTGAGGAGTCTATGAAGTGGAAGAAGCTAACTAATGCTCAGCGATCAGGATTGAACCAGATTCCCAATCGTAGATTCACCCTCTGGTGGTCCCCAACCATCAACCGAGCCAATGTATATGTAGGATTTCAGGTGCAGCTGGATCTGACAGGTATCTTCATGCATGGCAAGATCCCCACACTGAAGATCTCTCTCATCCAGATTTTCCGAGCTCACTTGTGGCAGAAGATCCATGAGAGTATTGTTATGGATTTGTGTCAGGTGTTTGACCAGGAACTAGATGCACTAGAAATTGAAACAGTACAAAAGGAGACAATTCACCCCCGAAAGTCCTATAAGATGAACTCTTCCTGTGCAGATATCCTGCTCTTTGCCTCCTATAAGTGGAATGTTTCCCGACCCTCATTGCTGGCAGACTCCAAGGATGTGATGGACAGCACCACCACTCAGAAGTATTGGATTGACATCCAGTTGCGCTGGGGGGACTATGATTCCCATGACATTGAGCGCTATGCCCGGGCCAAGTTCTTGGACTATACCACAGACAACATGAGTATCTACCCTTCACCCACAGGTGTGCTCATTGCCATTGACCTGGCCTATAACCTGCACAGTGCCTATGGAAACTGGTTCCCAGGTAGCAAGCCTCTTATACAGCAGGCTATGGCCAAGATTATGAAGGCAAACCCTGCCTTGTATGTGTTACGTGAACGCATCCGCAAGGGGCTGCAGCTGTATTCATCTGAGCCCACTGAGCCCTATCTGTCCTCTCAGAACTATGGTGAGCTCTTCTCCAACCAGATTATTTGGTTTGTGGATGACACTAATGTCTACAGAGTGACTATTCACAAGACCTTTGAAGGGAACTTAACAACCAAGCCCATCAATGGGGCCATCTTCATCTTCAACCCACGCACAGGGCAGCTGTTTCTCAAAATAATCCATACATCTGTGTGGGCTGGACAGAAGCGTTTGGGGCAGTTGGCTAAGTGGAAGACAGCTGAGGAGGTGGCTGCCCTGATCCGGTCTCTGCCTGTGGAGGAGCAGCCCAAGCAGATCATTGTCACTAGGAAGGGCATGCTGGATCCATTGGAGGTACACTTGCTGGACTTCCCCAATATCGTGATCAAAGGATCAGAGCTTCAACTCCCTTTCCAGGCTTGTCTCAAGGTGGAAAAGTTTGGGGACCTCATCCTTAAAGCCACTGAGCCCCAGATGGTTCTCTTTAACCTCTATGATGACTGGCTCAAGACTATCTCATCTTACACGGCTTTCTCCCGCCTCATTTTAATTCTGCGTGCCCTGCATGTGAACAATGACCGGGCAAAGGTGATCCTGAAGCCAGATAAGACTACTATTACAGAACCACACCACATCTGGCCCACTCTGACTGACGAGGAATGGATCAAGGTGGAGGTGCAACTCAAGGATCTTATCTTGGCTGACTATGGCAAGAAAAACAATGTGAATGTGGCATCACTGACACAGTCAGAAATTCGAGACATCATCCTGGGTATGGAGATCTCGGCACCTTCACAGCAGCGGCAGCAAATAGCTGAAATTGAGAAGCAGACCAAGGAACAGTCACAGCTGACTGCAACACAGACTCGTACTGTCAATAAGCATGGCGATGAGATCATCACCTCTACCACCAGCAACTATGAGACCCAGACTTTCTCGTCTAAGACTGAATGGAGGGTCAGGGCCATCTCTGCTGCCAACCTGCACCTAAGGACCAATCATATCTATGTTTCATCCGATGACATCAAGGAGACTGGTTATACCTATATCCTTCCCAAGAATGTGCTTAAGAAGTTCATCTGCATATCTGACCTTCGAGCCCAAATTGCAGGATACCTGTATGGGGTGAGCCCACCGGATAACCCCCAGGTAAAGGAAATCCGCTGCATTGTGATGGTACCACAGTGGGGCACCCACCAGACTGTGCACCTGCCTGGCCAGCTGCCCCAGCATGAGTACCTCAAGGAGATGGAACCCTTAGGTTGGATCCACACTCAGCCCAATGAGTCCCCACAGTTATCGCCCCAGGATGTTACCACCCATGCTAAAATCATGGCTGACAACCCATCATGGGATGGTGAGAAGACCATCATCATCACCTGCAGCTTCACACCAGGCTCCTGCACACTGACAGCCTACAAGCTGACCCCCAGTGGCTATGAATGGGGCCGTCAGAACACGGACAAGGGCAACAACCCAAAGGGGTATCTACCCTCGCACTACGAGAGGGTCCAGATGCTACTGTCAGACCGCTTCCTTGGCTTCTTTATGGTCCCTGCCCAGTCTTCATGGAACTACAACTTTATGGGTGTCCGGCATGATCCCAACATGAAGTATGAGCTGCAGCTGGCAAACCCCAAAGAATTCTACCACGAGGTGCATAGACCCTCGCATTTCCTCAACTTCGCCCTCCTGCAGGAGGGTGAGGTCTACTCTGCGGACCGAGAGGACCTCTATGCCTAGTTGTTTCCTCACCTGCTTCAGACTCCAGAAAGGCTGGATGGAGCCTTTACCCTGCAGACAAGCTGATGACATTCAACAGCTTGGCTCCTTTTTTCTCTGTTTTGTGCTTGTGTTGACCTCCTGATGGCTTGTAATCCTGAACAAAGTATAATAAATTTTGTATAAATTGGA