Transcript asmbl_2504

Sequence
Transcript Sequence for observation asmbl_2504 of TGE0007654:
GCCCCCCAATATAAAGGTCCGCCCTGGACTGGCCCAAGACAGTTTGGGAGTCAACTTTAAAGTCGTTGTCGCCGCACCCCGGACGTCCCGCTGACCGCGTGCGTGCTTCTGAGAAATGTCTACCAACGAGACAGAAGCCCCTGCCAACACCCATGTGACAGCAGAAGAACCGGTACAGCAGCCCAGCGTGGTGGACCGCGTGGCCCACATGCCCCTTATCGGTGCCACCTGTAATATGGTGTCCGCGGCCTACACCTCCACCAAGGAGAGCCACCCCCACGTCAAGACCGTCTGCGAAGCGGCGGAAAAAGGTGTGAAGACCCTCACAGAGGCTGCCATCAGCGGGGCCCAGCCCATCCTGTCCAAGCTGGAGCCTCAGATCGCATTGGCCAGTGAATACGCCCACAAGGGGCTGGATAAGCTGGAGGAGAACCTGCCCATCCTGCAGCAGCAGACGGAGAAGGTCCTGGCAGACACCAAGGAACTCGTGTCATCTAAGGTATCGGGGGCCCGAGACGCCATGTCCAGCACGGTGTCCAGCGCCAAGGACGCAGTGGCCGCCCGAGCGACAGGGGCAGCAGATGCGACCCGGGAAGCCATGCAGAGTGGCGTGGACATGACCAAGTCGGTGGTGACCAACAGTGTCCAGTTGGTGGGCCAGATGGTGCTGAGCGGGGTGGATACGGTGCTGGGCAAGTCGGAGGAGTGGGCGGACAACCACCTGCCCATGACGGACTCCGAGCTGGGTGAGTGTGGCCCGCGGGCCAGCCCCCACCCCGACACCCCCACGCAGAGTCCGTCGGTTTGAATGACATTTAAATGAACAAATAAATGGCCGGTGGGTGAGGGGAAGAACAGAGGAGAGTCTGAGTGATTTAATTCAGGGATCTGGACACCTGCTGAGTCCCGGGCCCGATCCTAGACATAGGGACACAAGCAGTGAGCAGGCTGGAGGACGGAATCCATGACCAATTCTGGAAAGAAAAAACCGAAGGTGGGGCAGGCGGGGGCGGGGAGGGTTTCAGGACAGTGTGGGCTAGGGCAGCGTATGTTTAGAGGCCCCGTGGGAAGGTGGCATTTGAGCATAGAACTGGAGGTAGAAGGGAGCTAGCCATCTGAATACTTGGGTGAGGCCACAGCCCGTGCCAAGGCCCCGGGACAGGATCGTGCCTGGCGTGTTGGAGAAACAGCTGGGAGCCCCCTGTGGCTGGAGCAGAGTGGGCGAGGGGGCGAGAGGTAGGAGGGGAGG