Transcript asmbl_59390

Sequence
Transcript Sequence for observation asmbl_59390 of TGE0010420:
GGAGCAACTAAAGTTTCTCTGCCAAGACCTCGTCTCCCGCAAGAATCTGGAGAAATGCAGCTCGGCCTCGGATATTTTTGAACATCTGTTGGCAAGGAAGCTGCTGAGTGAGGAAGACCCCTTCTTGCTGGCAGAACTCCTCTATATCATCAAGCAGAACTCACTGCTGAAGTACCTCCACTACACCAAAGAGCAGGTGGAGAATTTGCTGCCCACGAAAAGGAAGGTGTCTCTGTTCAGAAACCTGCTCTACGAAATGTCAGAAAACATCGACTCGGAGATCTTAAAGAGCATGATCTTCCTTCAGAAGGAATCAATGCCAAAAATGCAGATGACCTCTCTAAGTTTCCTGGGACATCTGGAGAAACAAGCTCAAATAGGTGAAGATGATCTGAAGGTGCTAGAGGACCTCTGTGCAAAAGTTGCACCTAGTCTTGGGAGAAAGATAGAAAAATATAAAAAAGAGAAAGCCTTCCAGGTAGTGACATCTCCTGTAGACAAGGAAACTGAATCATTGCCTCAAGGAAAGGAAGAAGTTTTTTCCTGTTCAGACGTTCAACAATTTCTTGGAGCCTTACCGGCAAGTTCATTGAAGTCACCTGTGTACAAGATGGATCGGAAATGTAGAGGCCAGTGCGTTATTATCAACAACCACAGCTTTACCGTTACCTCACTGTCAGAAAGACGAGGGACCCAAAAAGATGCTGAGTGCCTTACACATGTGTTTAAGTGGCTTGGGTTCAATGTAAATATATATAATGATGTGACTAAAGAAAACCTGGAGGAAGTTCTGATAAAATTTCAGAGCCATCCAGACCATGCTGATGGAGACTGCTTCGTGTTCTGTGTTCTGACCCATGGGAAATTTGGAGCTGTCTACTCTTCGGATGGGGTCCTCATTCCCATTCGGGAGATCATGTCTCACTTCACAGCCCTGCAGTGCCCTGGTCTGGCTGACAAACCCAAACTCTTCTTCATCCAAGCCTGCCAAGGAGAAGAGATACAACTTTCTGTATCCATTGAAGCAGATGCTATAAATCCTGAGCCCACACACCCTCCCCTTCAAAACAGTGTTCCAAATGAGGCCGATTTCCTTCTTGGTTTGGCCACAGTCCCTGGCTACGTATCTTTTCGGCATACGACGGAAGGTAGCTGGTATATTCAATCTCTGTATAATCATTTGAAGGACTTGGTCCCAAGACATGAAGATATCTTATCCATTCTCACTGCTGTCAATGATGATGTAAGTCGCCGAGGTGGAACAAGGAAACAGATGCCTCAACCTGCTTTCACACTACGTAAAATTCTCATATTCCCTGTACCAGAGGAAGAACTTTGATTATAGTAGCGAGTTTTCATTGACTCTTAGTCTTGAAAGGAACCTTGTCATCTTTTCCAATTTTCACTCAGCATAGGAATCAGATGGTGAACTGGTCTCCCCTGTCATTCTTATAATAAGAAATGCCTTGCTTGTTTCCTGACATGGCAAATTCTGTTTTCTTTCGTTCTTTTTGACAAGTCTAAACATTAGAAAACTTTCTTTATCGATGCCTTGGATTGTAATCATGGCTTTAGTTGTGCACTCTGAAAAAAAAGTAATTGGCCTCAGTTTGTGTATCTGTGAAGTCAAAGCTGAGACCAGGTACATTTTAAGATTCCTCTTAGTTCTAGGAACCAATGTTCTTAGATTTCCCCTCTATATGACCACTCTTTGTTATACTTCTGTGTGACCTCTGCATGGCCTTGTTTTGGACATTGGCTGGTGACAAGACCATGGTTTGCTGACCCTCTCTCTGCTCTCCCCTTCCCAAGTCTTCTCTTCTGCACATCTACTGGGGGGAAAATGTCCTGCTTTAGAGTCTAGGAGGGTGCAAGAACTGTTTTTCTTGGGTTGGGAACTGGGTTGGCTCTTGGAAGATGACAGCTCAGTGTGAAGAGAGACACATCCAGCTACTCTGGGAACAGAAACTTGACAACTTGATGTTCCTTCCATGTTGGTCACAACCTCTCAGATGCTGGTGATGGAACGTTTTTTTCAATTTCGAGAGGAATTTTTCTTTTTAAATTTTTGGAAGAAATTAAATTTTAATTCCTGGAAAGAGGGAGATTGAAGCCTTCAATTTTAGATGAAGAGGCTGAGGCCCAAGGAGGCAGAGCAATTTGCTACAACCTTTCAACCTGTTATTGTTTACATGATTTTATTTCCCATGTAAGTGAACTGGACTGTCAGGGGACATAACAGAACTTTATGAATGTCTCCTTGAATATACAGCTGCTCAGGAAAGATGTCAGGGAGTGAAGAAAACTCTCAGTGATGCCTAATTTTATAATTATTTCTGTGAAAGTCAAATTAATTTATGGTGAACTCACTATGAGAAATATTTGTAAGAACTTTGTTATAATGTAGCTAGTAATCACATGGGTTTGACTGTAGCTTGACAAAGAAAACGAATCTAACACATATGTCAGGATGGTCCTCCAAAACTATTGTTCATACAAGTCGAAACTAACAGCTGGTGTTTACAGTCTTTGTCCTATTGGATATGCACAGCTTTTGGCCATTTAACAGTCCTCTGCAAGTGAAGCGTGCAGTAGTACAAAGGAGAGAGCAAAGAAGAATCTGGAGATAGAAACCTTGGGTTTTGATTTTACCTTGTGATTCCCTTGTTCTGAGACAGTAGCTCAAACTAATTTTTCAAACTTTCTCTATAAAGTAGAGAAAATACTATCTGTTGGGAGGATTAAGGAATATATATATATATATAT