Transcript asmbl_250064

Sequence
Transcript Sequence for observation asmbl_250064 of TGE0000759:
GAGCCCGGCACGCGCTAGCCTCCGACTGTCCTGCGGTTCTTCAAAAAATGGATAGCCAGCCTGTTTCTCTGATCACATCACTATGAGAGAAAGTGTGGATGAAGCCCAATAGCGCTGCTCCATGACCAGATCCAACCTTGAACAGTGGTCCCATCTGCCTCTTGGGCACAAGAGAGCCTGGATGAGAGAGAGAGCATGAATTTTGCAGTCAGAAAAATCTGGGTTTTCAGTTTCTGCTACCTCACTTAGCTGCAAATTGAGGATGACACTAATTGTGTTGTGAGGAAGTGGCATAAATTGTGTTCTTCTTTTTCTCTTTTTGATCTTTTGAGCTCTCTTTAGCAGCCAAGAAAATTCAGACAGAGATGGGGTGATCAGCTGGAGCCAACCAAGCAAGGAGTTGGAGCCAGAACTCAGAATATTCTCCTTGGGTTTTTGCATTGGGTACTCCAGACCGGGAAGAAAGAACAAGGGGTTGTCCCATCATTAGAACTTTTTAACTTTCACAACTATGCATTCACCCATCCAATGTACTATTTCTGAAGTGCTTACTATGTGTAAAGCTCAGAGTCTGCAGTAGTGTGAGCAAAAGACTGGTTCCCGCCATCGACGAACTTACTGTCTTAATGCTGTCCTTTGCAAGTTGCAAACATTAATTCATGTGATTTTCACAACTGGATGATGGCATTACTAGGATTAGGTACACTTTACAGAGGAGGACATACTAAGATTAAGGATAGCACTGGTGCAAAAACAAACTAATATCTTTGGTGATCTATTCTGCTCTCCAGAGGCTGCCAATCTACTGAGAGCGTGAATATAAGATTGTTTTTGTCTGATATCTGCCTCTTTATTTTCTCTCTAATTTTTTGTTGGCCAATAAAACACTCTTCCAGAAAATACCCGACGCCTGCAAGGAGTAGGCCACTCTAGCAAAATCCACTCATCCCGCCTGCGCAATACAGCGTGCTTCCGGCTTCCACTACCCACGTGACCAGGCACCTTCGCTGCGCGTGCCTAGTAGGAAGTAGGACTATACCACTTTGCCTTACCAAAGGGGTCTAGTTCCTATGTTTTTAAGTTTAAAAACTATTCCCGCTATTAGGCTTTCTATTATCTCGAGTCTTTACACGGGATAAGTAAGTTTAAGGGTGGCAAAAGATGAAAGGACCAGAGGGAATACGGGCGAAAGCAGAGCGAGGGTTGGCCTCTCCCCTTCACAAATAATGGGAGGAACCTGGCAAGAGGGAGTTCTTTCCTTTCGCCGCTGCGGTCGCAGCCATGAGTATGCTCAGGCTTCAGAAGAGGCTTGCCTCCAGTGTTCTGCGCTGTGGCAAAAAGAAGGTCTGGTTGGACCCCAATGAGACCAATGAAATTGCCAATGCCAACTCTCGTCAGCAGATTCGGAAGCTGATCAAAGATGGGCTGATCATCCGGAAGCCTGTGACTGTCCATTCCCGAGCACGATGCCGGAAAAACACCTTGGCCCGCAGAAAGGGCAGGCATATGGGCATAGGTAAGCGAAAGGGTACTGCCAATGCTCGAATGCCTGAGAAGGTAACCTGGATGAGGAGGATGAGAATCCTTCGCCGACTGCTCAGAAGATACCGTGAATCTAAGAAGATTGACCGCCACATGTATCACAGCCTGTACCTGAAAGTGAAGGGTAATGTGTTCAAAAACAAGCGGATTCTCATGGAACATATCCACAAGCTGAAGGCAGACAAGGCTCGCAAGAAACTTTTGGCTGACCAAGCTGAGGCCCGTAGATCTAAGACCAAGGAAGCACGCAAGCGCCGTGAAGAGCGGCTCCAGGCCAAGAAGGAGGAGATCATCAAGACTCTGTCCAAGGAAGAAGAGACCAAGAAATAAAGCACCACCTCTCTTACCTGTACATAGTGGCCTTGGCAATTATATAGATCAATCCTTCAATAAAATAGCTTTCATCTGCCTACCTCTCTGTTCTTCCAAAGTTTCTGGCTGTTTGATGAGTCTTCACTATTTAGAGGGCCAGAACTGAGCACACCGAGTTCTGAGATGCAGACCCTCTCCAGAGTGCCAGTTTTCATTCTTTCCTTGGCTCCTGGCCTCTGATAAGGCTCATGACCCCTCTGTCCATGGAAGAGACGGTTTTTTTACCTTGTTTTAGTGGGATGTGGGGCTTACTTTGAAGGGAGGGAAGGAATGACTTCTACTCAACTTCCGAAGTGCTGTGCTTTAAACTGCCTTTTACAGTAGAGCGTGAGTGGCATTTCAGAAGTGGTCTCAGATGTTGGTTGGGAACCAATAGTTGTGACATCAGCTGTCATTGTTTTAAAAACAAAAAACAGAATGCTTACACTTTTCAACTGGGCACTGGGGTCCAAGGTTGAAATCTGCCCTAGAACTCAAGGACAGTGAGAGTTTCAACCACCTCCAGTCAAGCTAATGACACCTGGACTTCACTGACTGCTACCTATGCTTTCTCTAAACAACTTTATTGAAGCTGTCATTTTGAACATTCCAGTTTCTAAACCTTTATGTCCTATCAGGGTTTTGTTTTTTGTTTTCTGTTTTACACTGATAGATTACAAAGAGAAAGGCTTTTCTCAGAAATTGGAATAAAGGCACGCAACAAAAACTGGTCAGCCATTGTGAGTTGCTTAATGAATTCATATTCTCTTTTACCAGATAGGAAGGTTTTATTTTGCCACTTAGCAATAATAAGTGCCA