Transcript asmbl_250031

Sequence
Transcript Sequence for observation asmbl_250031 of TGE0007325:
TTCCCCTTTGGTGACTCGGCCATCGGCCTACCGGGCCTGGCGTTTCCCAGAAGGCCCAGCGCTGGGAAGGGGTTTGCAGCTGCTCCGTCATCGTGCGGCCCGACGCGAGCCCGCGCTCGTGTGCAGGCCCGGCTTGGTTCCTGGTCTCTGGTGCGAGGGTTCACACGAGGCCCCGGCCTCGGACCCCGGACTAGGCCGCGACCCCGGGCGCCATGAAGCAGGAGGGCTCGGCGCGGCGCCGAGGGGCGGACAAGGCGAAACCGCCACCCGGCGGAGGGGAACAAGAACCACCGCCACCCCCGGCCCCCCAGGATGTGGAGATGAAAGAGGAGGCGGTGGCAGGTGGCGGATCAACGGGGGAGGCTGACGGCAAGACGGCGGCGGCGGCGGCTGAGCACTCCCAGCGAGAGCTGGACACCGTCACCTTGGAGGATATCAAGGAGCATGTGAAACAGCTGGAGAAGGCAGTTTCAGGCAAGGAGCCTCGATTTGTTCTGAGGGCCCTGCGGATGCTGCCTTCCACATCACGCCGCCTCAACCACTATGTTCTGTATAAGGCTGTGCATGGCTTCTTCACCTCAAATAATGCCACTCGGGACTTCTTGCTACCCTTCCTGGAAGAGCCCATGGACACAGAAGCTGATTTACAGTTCCGTCCCCGAACAGGAAAAGCTGCATCAGCACCGCTGCTGCCTGAAGTGGAAGCCTATCTGCAGCTCCTCATGGTCATCTTCCTGATGAACAGCAAGCGCTACAAAGAGGCACAGAAGATCTCTGATGATCTGATGCAGAAGATCAGCACTCAGAACCGCCGGGCCCTGGACCTTGTGGCTGCAAAGTGTTACTACTACCACGCCCGGATCTATGAGTTCCTGGACAAGCTGGATGTGGTGCGCAGCTTCTTGCATGCACGGCTCCGGACAGCCACCCTTCGGCATGACGCAGACGGGCAGGCCACCCTGCTTAACCTTCTGCTGCGGAACTACCTACACTACAACTTGTACGACCAGGCTGAGAAGCTGGTGTCCAAGTCCGTGTTCCCTGAGCAGGCCAACAACAATGAGTGGGCAAGGTACCTCTACTACACAGGGCGGATCAAAGCCATCCAGTTGGAGTACTCAGAGGCCCGGAGAACAATGACCAATGCCCTTCGCAAGGCCCCTCAGCACACAGCTGTCGGCTTCAAACAGACTGTGCACAAGCTTCTTATTGTGGTGGAGCTGTTGCTGGGGGAGATCCCGGACCGACTGCAGTTCCGTCAGCCATCCCTCAAGCGCTCGCTCATGCCCTACTTCCTTTTGACCCAAGCTGTCAGGACAGGAAACCTAGCCAAGTTCAACCAGGTCCTGGATCAGTTTGGGGAGAAGTTTCAAGCAGATGGGACCTACACCCTAATCATCCGACTGCGGCACAACGTCATTAAGACAGGTGTGCGCATGATCAGTCTCTCCTATTCCCGAATCTCCCTGGCCGACATCGCCCAGAAGCTGCAACTAGATAGCCCAGAGGATGCAGAGTTCATTGTTGCCAAGGCCATCCGGGATGGCGTCATTGAGGCCAGCATCAACCATGAGAAGGGCTACGTGCAGTCCAAGGAAATGATTGATATCTATTCCACGCGTGAGCCCCAGCTCGCCTTCCACCAGCGCATCTCCTTCTGCCTAGACATCCACAACATGTCTGTCAAGGCCATGAGGTTTCCTCCCAAATCATACAACAAGGACTTGGAATCTGCAGAGGAACGGCGTGAGCGAGAGCAGCAAGACTTGGAGTTTGCCAAAGAGATGGCAGAAGATGATGATGACAGCTTCCCTTGAGCTGGGGGGCTGGGGAGGGGTGGGGTGAGTGGGGACTGGCTCTTTATCTTTCCCCTCAGGGGTCCCATGCCCAGGGAACTGGCCCTTTTTCCCACACACAGCTCACAGACTGCATATGTGCTGGGGGCGGGCGGGGTGAAGGGTGTAGAGAGCCAGCCACCCCCACCTCACCTCAGGGCCCCTCCCCAGCCGGTGATTTAGCACACAGTGGTCAAGAGGGCGGGCAGACAGCCTCCCCAGGGCAGGGTCCTGGCTAGTGGTGTGGGCAGCAAGATGGGAGGGAAAAGCCCTGTGCTCTCCTCCAGGGAGTAGGGGACTGGAACTGGGACATGTGTCGGGTTGTATGTTTTTTGAAGCTTCAATTATGATTTTTAAACAATAAAAGTTCTCCAAAGC