Transcript asmbl_250000

Sequence
Transcript Sequence for observation asmbl_250000 of TGE0000763:
CCGTCATTTGCCCCGCCGGTCTCTGGGGGCGCTGTGCCGGCGGCACCTTCTCTCCATCTCCGGAATTCGTCTTGCGGGACGGAAGCTGGGGGTGCGCCCCGACCCAGCACGGATTGACCCGGAAGAACGGCCGTGCTGCTCCTCCGCTGGTCCCGGGGGCCCGGCCGGGGTTCTGCGAGGACCCCGGGAGGGTTGAAGGCTAAGCATGGGGAAAAGCTGCAAGGTGGTCGTGTGTGGCCAGGCATCTGTGGGCAAAACGTCAATCCTGGAGCAGCTCCTGTACGGGAACCATGTAGTAGGTTCTGAGATGATTGAGACGCAGGAAGACATCTACGTGGGCTCCATTGAGACCGACCGGGGGGTGCGGGAGCAGGTGCGTTTCTACGACACCCGGGGGCTCCGAGATGGGGCCGAACTGCCCCGACACTGCTTCTCCTGCACTGACGGCTACGTCCTGGTCTACAGCACAGACAGCCGAGAGTCCTTTCAACGTGTGGAGCTGCTCAAGAAGGAAATCGACAAATCCAAGGACAAGAAGGAGGTCACCATCGTGGTCCTCGGTAACAAGTGTGACCTGCAGGAGCAGCGGCGTGTGGACCCAGATGTGGCTCAGCATTGGGCCAAGTCGGAGAAGGTGAAGCTGTGGGAGGTATCGGTGGCTGACCGCCGCTCCCTCCTGGAGCCCTTCGTCTACCTGGCCAGCAAGATGACCCAGCCCCAAAGCAAGTCTGCCTTCCCCCTCAGCCGCAAGAACAAAGGCAGTGGCTCCTTGGATGGCTGAGGAGCTGCCATCCCTTCTTCACCTTCCCAGCCTCAGTCCAGCTTCTGAGGCTTTGGAAGAGGGGTTGAGGGGAAAGGGGACCCCCTGCTAGGCCTGGCAGCTGGGCTGTCCCAGGCTCGGGACACTTTTGTTTCCTCCCAACTCCGGGAAGTGCAAGTAATCTAGGTTAGCACCCCCAACCTCTTTCTCCATCCCTGCTTTCATCATATCTGCCCTGCTGTGACCAGGGGCAGTTGTGAGTCAGTGTCCTTTCAACCCATCCTGGATGGGAAGCATAGTTACCATGCAGAAGTGCCCAGTCTAGGGTCTGGTTTCAGTCACAGGGGTCCCATGTCTCTGAGCCTCTGTCGATGACATACACACACACACGTGCGTATGGCAACAGCCTGGACTCTAGGGAAAGGGTGTCCAGGTATCGCGTATGTGTGTGCATGCTGGTGTTAGGGGTGCCTCCTCATCCAGCACCTTGACCTTCCTCTTGTCTCTACCTTGGCTGGAAGCCAGCCTCCTGGGAAGTGTGATTTTCTATTTGACCTCTTCCCCCAATTGTTTCACTTCCTATTCCTGCTCAGGGAGCAGATGGGCCTTATTAGTTGACGTGGAATGGAATGATGACAGGGCTGTCGCCAGTGGGCTTTGTGACCCAGCAAGCCTTTTCCCTCTCTGGGCTTCAGTTTTCTCATCTGTAAAGTGACAGGAGTTGCTTAGATGAACTTCTAGATCCTCTCCAGCCCTGTGATTTCATAATGCTCATGGCTTCGGGCCGGTTATGACTACCGTTTGCTTCTCCCTCTTCCAAGGTGCTATGCCTACCAGCCCTAGAGGCTGAAACACTGCTTTCCACCAACCACTATGGGGCAGGAGTGCACTATCTGCTCTAGTTGACAGAACGACTGCTCAGTGCCCAATGGGGAACCTCACCCATGGGGGCTGGTCTTCACCCCTTCCTGTGGTTGTTTCCAGCTAAGAGCTGGACTTTATTTATAAATTACCTGTTATAAATTAGTATGCTGCCATGGTTAAGGCTGGACAAGGTGCTCCTCTAGCCCTTCTTACCTCAGATGCCTGAACAGAACAAGGCAAACAAATAGCTTCTCGGAAGCTGACGGATCTGTTGGGGCTCAGAAGGGTGGTTACACTCTCACCATGCTATAAAGTGAGCTTATGACCCACAACTTTCTGTGTCCGCTTTGTGCTGCTTCTCATGGAGACAGCTACCATAGGTGAGCCCTTATAGCCAGGCGACCTCTAATACATGACTCTTCTCCCCCAAACAGGAGAAGTGAACGGGGGAAGGTGGCCCAGGATAGGGTGAGTCAAGTTAGGGCGTATACAGGCTCGGGCTTAAAGTTCATTTATTGATGCATCGGACACAATAAAACCACAACTGTTATCAAAAAGTTTCCCTCTCCTCCCCCCCTTTTCCTTGTTCTCCCATTGGAAATATCTTAAAAAATAGATACAGG