Transcript asmbl_249423

Sequence
Transcript Sequence for observation asmbl_249423 of TGE0007406:
CAGAGATTTAGTCCACTTAGTTCAACAAATATTAGGAGCTTTGGAACACAAAGAATACCCGTAGAGGAATAATGAGGAATATTCTCCAGCCCTTTCCTTTCACAGATGGGGAAATCAAGACCTGGAAGAAAAAAGTAACTTGACTGGAGGAGGAAAGGAACTTGCCCAAGGCACATCTGGCTGCCTGACCAACATCTGCCTGGAGTCTGTCTCTTAAAGACACAGCTGTGGTCACTGGCTTCCAGTCCTAACTCTACCTCCCATGAGCTGCGTGATCTTGGACATCCAGGTTGCCTGTGACCTTTTGAAGTTCCCTTTCTGTTGATTCTTCTGCGAATAACCCGACCTTCAGGCTCCGCCCACCTACCTCCAACTGGCAACACCCACTTACACACCTGTGGGGGCTGGCGTCCCTGCCCAGTCTCCAAACACTAGGTCTGAGCCTGAGTGGGAGGAGGAGAACTTTAGGATTCTGCGAGGCTGGCTCTTAGGAGCAGTAGACGAGAAATTGTGTAGTCTGGGCCCAGTTCCCTGGCCACGCAGGACACTCTTAAGAGAAGGGACTCATTTCCACATCGACGGCCTTACAAGGGAGATCAGAAGGCACAGCCTTTTGGGGAAAATGTTGTCTTGTTGTTAATTATAATTATGGCTGCTTGGTTATTTACTACTGCTAAATATTTGGCTTTGCTGAGGGACCATTCTCAGCTGGGATCAGGGGCAGTGGGGCGGGTGGGCAGGAATAAAAAATCTCGACGAGGACAATGAAGGGGCCGATTCCGAGGAAAAAGGCCCAGAGACCGCCAGCCGCCTCTCAGGAACTCATGGTGGGGGCGAGTTGGGCTTTTAAGCCAGAGGCGCGCGGTGGTCGGTTCCCAGATGTGCCAACGCCGGGTCTCTCCAGTTCGGCCGGCGGCGGTGGCCACGCCTGGAACGACCTTTCCAGCATCAGTAGCAGCCGCAGCAAACCCGCCGGACAAATCCCACCCCGGGCCCCATGCGTCCAATCCGTCTTGCTTGGGAGGCGACGCTGCTCGGGAAGCAAAGGGTGGGGAGGGGAAATCCAAGCCTTTGGGGGCTCCCGACAGGTGTTTGGGGGAGAGGGCGGAGCCGTATTAGAGAGGATGAGGGAGGGGCGGTGCTGCCCCTTTAAGAGGCGGTGGCCGAACCGGGACCTTTTCTCTTTCCCCGGAAGGAGAGCGAAGCCGCGGCTGGGCGCGCAAGGTGGGGAGGTGCGGAGCTGGGCTTTGGGAGGCGGGGCGCGCGCGGGGGGGTACCCCTCCCTTCGGTCCTCCTTGCGGTGGACGGGTCTGCCTGCCCAGATCCGCCGCCCAGCGAGGATCCAAGGCATCTGTGCGGCCCGGGGGGCTCGGCCGGGACAAGCTAGGGGCACGGTGCCCGGGGCGGGTGGGCGGTGACCCGACGCAGGGCAAGCGGAAGAATAGATTCGCGGACCTCCGAGGGGAACCTGAGAGTGCAGACCTTGAGCGGACGTGAAACCGGCGCGGTCCGGGGGCCGGGAACTGCTCAGCGCTGCAGGGCTCCACGGCGCTGCCCGCCCGCGCGTTTCCAGGGGCGCGGGGAGCAGGTGAACAGGTCCTCGCTCACAGCTCCACGCCCTCACGCGCTCTCGCCCCGGCCTCCGCTCCCGCTTGCAGCCATGGGCCCGGGTCTCCGCCTCGCCACCCGCGTCCCACGCCAGATGCTTTGCGCGCTGGCCTTGATGGTGGCCGCTGGCGGCCGCATTGCCTCTGCTTTCAACCTGGACACCCAATTCCTGGTGGTGAAGGAGGCCAGGAACCCGGGCAGCCTCTTCGGCTACTCGGTCGCCCTCCATCGGCAGACGGAGCGGCGGCGGCGCTACCTGCTCCTGGCTGGTGCCCCCCGGGATCTTGCTGTGCCTGATGGCTATACCAACCGGACTGGTGCTGTGTACCTGTGCCCACTCACTGCCAACAAGGACGACTGTGAGCGGATGGACATCGGAGAGAAAAGTGACCCTGACCATCACATAATTGAGGACATGTGGCTGGGGGTGACTGTGGCCAGCCAGGGCCCTGCAGGCAGAGTCCTGGTCTGTGCCCACCGCTACACCCAGGTGCTGTGGTCGGGGCTGGAGGACCAGCGGCGCATGGTGGGCAAGTGCTATGTGCGGGGCAATGACCTAGAGCTGGACCGCACTGATGACTGGCAGACCTACCACAACGAGATGTGCAACAGCAACACTGACTACCTGGAGACGGGCATGTGTCAGCTGGGCACCAGTGGCGGCTTTACCAAGAACACTGTGTACTTCGGTGCTCCCGGTGCCTACAATTGGAAAGGAAACAGTTACATGATTCAGCGGAAGGACTGGGATTTATCTGAATACAGTTACAAGGGCCCAGAGGACCAAGGAAACCTCTATATTGGGTACACAGTGCAGGTGGGCAGTGCCATCCTGCACCCCACGGATATCACCATTGTGACAGGTGCCCCACGGCACCAACATATGGGCGCTGTCTTCTTGCTGAGCCAGGAGGTAGGCGGAGACCTGCGGAGGAGGCAGGTGCTGGAGGGCACACAGGTGGGCGCCTATTTTGGCGGTGCCATTGCCCTGGCAGACCTGAACAATGATGGGTGGCAGGATCTCCTGGTGGGTGCCCCCTACTACTTTGAGCGGAAAAAGGAGGTAGGGGGTGCCATCTATGTCTTCATGAACCAGGCAGGCACCTCCTTCCCTGCCCACCCCTCCCTCCTTCTTCACGGTCCTAGTCACTCTGCCTTTGGCTTCTCCGTGGCCAGCATTGGTGACATCAACCAGGATGGATTCCAGGACATTGCTGTGGGAGCTCCATTTGAAGGCTTGGGAACAGTGTACATCTATCACAGCAGCTCCAGGGGGCTTCTCCAACAGCCCCAACAGATAATCCACGGAGAGAAGTTGAGACTACCTGGCTTGGCCACCTTTGGCTACTCCCTGAGTGGGCGGATGGATGTGGATGAGAACTCCTACCCGGACCTGCTAGTGGGGAGCCTTTCAGACCGCATCGTGCTCCTGAGGGCGCGGCCTGTCATCAACATCCTCTATAAGACCTTGGTGGCCAGGCCTTCGGTGCTGGACCCCACACTCTGCACAGACACCTCTTGTGTGCAGGTGGAGCTGTGCTTTGCTTATAACCAGAGTGCTGGGAACCCCAACTACAGGCAAAATATCACCCTGGCCTATACACTGGAGGCTGACCGGGACCGCCGCCCACCCCGACTTCGCTTTGCACAGAGCCAGTCAGCTGTCTTTCATGGCTTCTTCTCCATGCCCGAGATGCGCTGCCAGACGTTGGAGCTGCTCCTGATGGACAACGTCCGTGACAAACTCCGTCCCATCGTCATCTCCATGAACTACTCTTTATCTTTGCGTATGCCGGAGCGCCCCAGGCTGGCGCTGCAGTCCCTGGACGCCTACCCGGTCCTCAACCAGGCGCAGGCTCTGGAAAACCACACTGAGGTCCAGTTCCAGAAGGAGTGTGGGCCGGACAACAAGTGCGACAGCAACTTGGAGATGCAGGCAGCCTTCGTGTCCGAGCAGGGGCAGCCGATGAGCAGGCTCCAGTACAGCAGAGACTTTGGGAAACTGCTCTTGAGCATCAATGTGACTAATATCCGGAGCAGGCAGCGGGCTGGAGAAGATGCCCACGAGGCGCAGCTCACCCTGGCGGTACCTCCCGCCCTGCTACCGTCCTCAGTGCGCCCTTTTGGGGCCTGCCAGGGCAACGAGACTATCCTTTGCCACCTGGGGAACCCCTTCAAACGGAACCAGCGGATGGAGCTACTCATCGTCTTTGAGGTCATCGGGGTGACCCTGCACACAAGGGAGCTCCAGGTGCAGCTGCAGCTGTCCACGTCAAGTCACCAGGACAATCTGCAGCCCATGACCCTGACTCTACTGGTGGATTACATGCTCCAGGCCTCACTCAGCATGGTGAGTCACCGGCTACAAAGCTACTTTGGGGGAACAGTGATGGGTGAGTCTGGCATGAAAACTGTGGAGGATGTGGGGAGCCCTCTCAAGTATGAGTTCCAGGTGAGCCCAATGGGGGAAGGGCTGGCAGCCCTGGGCACCCTGGTCCTAGGACTGGAGTGGCCCTACGAAGTCATCAATGGCAAGTGGCTGCTGTACCCTACAGAGATCACCATCCGCGGCAATGGGTCCTGGCCCTGCCAGCCACCCGGAGACCTTGTCAACCCTCTCAACCTCACTCTCTCTGTCCCTGGGGATAGGCTGCCAACTTCACAGCGTAGGCGAAGACAGCTTGACCCAGGGGGAGGCCAGGGCCCCCCACCTGCTACTCTGGCTGCTGCCAAAAAAGCCAAGTCTGAGACCCTGCTGAGCTGTGGCAGTGACCACACCCGCTGCGTGTGGCTGGAGTGCCCTATTCCTGATGCCCCTGTCATCACCAATGTGACTGTGCAGGCTCGAGTGTGGAACAGCACCTTTATTGAGGATTACAGGGACTTTGACCGAGTCAGGGTAACCAGCTGGGCTACCCTGTTCCTCCGAACCAGCATCCCCACCATTAACATGGAGAACAAGACCGTGCCGTTCTCTGTGGACATTGACTCTGAGCTGGTGGAGGAGCTTCCAGCTGAGATCGAGCTGTGGTTGGTGCTCGTGGCTGTAGGTGCCGGGCTGCTGCTGCTGGGGCTCATCATCCTCCTGCTATGGAAGTGCGGCTTCTTCAAGCGAGCCCGCACTCGCGCCCTGTATGAAGCCAAGAGACAGAAGGCGGAGATGAAGAGCCAGCCGTCAGAAACAGAGAGGCTGACCGAAGACTACTGAAGGGGGCGGCCCCTGCCCCCAACCCACCCGGTGTGACTTCTTTAAACGGACCCACTATTACCAGATCATGCCTAAGTACCACGCGGTGCGGATCCGGGAGGAGGAGCGCTACCCACCTCCAGGGGAGACCCTGCCCACGAAGAAGCACTGGGTGACCAGCTGGCACACTCGGGACCGATACTACTGACATCCTCCCTGATCCCACCCCCGTGCCCCCAGTGTCCCCTTCTATTTATCATAAGTTATGCCCTGACAGTCCACAGGGGCCACTGCCTTTGGCTGGCGCCAGCAGGCTCAGGCACACACACCTCTTCGAGCGCATACATGTGTCGTCTGGCCACAGACTTCTCCGCGCAGGAGTGCTGGGACCGTGGACCTTGCTCTGCCAAGCACACCACAGACCTGTGCCCTGGACACATGTGGATACATGTGGGTCCCACTGTGCTTGTGCACCACAGATGGTTTATGGACATGTGTGTCCCAGCCTCTGCTAGAGCCAGGAGGAAAAGGCTCCCAATGTGGTGACACCTTTCTTGTTCACACTGGACCCATCTTGAGCCATAGTCACTGGATGGACTCTGCTCTCAAGATTAAAACTACTGACAGGGAACAGCCCACCAGGCTGTACCTCAAGCTGTAGTTCCTGGCACCCATGCCAGAGAGCGTGAGGTCTGCCTGAGGTTGTCTAAGGGGGTGTTTGTAGGACCCAGCATGCTCAGACACAGAGCAGAATGAACTAAAATGAGGGTCCCCAGGATGACTTTCTTTCATGGATCTCTGTGAAGCCTCTCTCCTCAGCCACAGCATGTCCTAGCAGGGAATGCGGCCTAAAGGAACAAAGATAGACATCCTGGCATGCTGTGCGGGGACTGCCCTGGGAGCACAGTGGAATCCTCAACAGAGGAGGGGACCGGCCCTGGGCCAAGGAGATGTTGGAAGGATACATAAGAAATACCACTTCTCACCCATCACTACCATCCCGGCCTCTGAAGGGCCTGGAGAATTCCCACAAGATCACAGAGGGAGCGACACTTGAATGTAGGACAGGGAGGAAGCCCTGTCCCTGTCCCATTGGCCAGACCCCACTCTGCCCCCACTGACCAAGGGTTAGGGGCCAAGAAGTGGAGTTCTTGGCTGTCCTTGGCTTTCATCACCTATCGGCTCTGCCTTCTCCCCCATGGGCTGAGTCCTGAGGCCCATTCTAGAAGTCGAAGCTGGTTCCAAAAACCCTCTCCTGCCCCCTGCCTGTTGGCAGCTCCCCTTACCCCCTTCCACGGTACTGTAGTAGGGGAGCTCCCTCTCCCTCCTTGTGCCTTCTTTGTATATAGGCTTCTCACATCAACTAATAAACAGCTCCCTGTTTGT