Transcript asmbl_249223

Sequence
Transcript Sequence for observation asmbl_249223 of TGE0007380:
GGGAACGCGTGTGACCAATCGCCGGGCGGCTCGCAACGTGAGCTGATGGGGGCGGAGAGAAGCCCTCAGAGGCCAGGACAAAAGCCGGATCCCGGGCGGTGGCGGGAGGGTGGCGCGCTCCGGGTAGTGGCCTGTGATTCAAGGCCTGTGGAGGGAGCGCCGCGCACAGACTTTCGCAGAGAGGTAGAGCAGGTCCCTCTGCAGCCATGTCGGCCAAGGCGATTTCAGAGCAGACTGGCAAAGAACTTCTTTACAAGTACATCTGCACCAGCTCGGCCATCCAGAACCGGTTCAAGTATGCCAGGGTCACCCCTGACACAGACTGGGCCCATCTGCTGCAGGACCACCCCTGGTTGCTCAGCCAAAGATTGGTGGTCAAGCCAGACCAACTGATCAAACGACGTGGAAAGCTGGGCCTAGTTGGGGTCAACCTCACTCTGGATGGTGTCAAGTCCTGGCTGAAGCCACGGCTGGGACAGGAAGCTCTGGTAGGCAAGGCCAGAGGCTTACTCAAGAACTTTCTGATCGAACCCTTCGTCCCACACAGTCAGGCAGAAGAGTTCTACGTCTGCATCTATGCTACCCGAGAAGGTGACTACGTCCTGTTCCACCACGAGGGAGGGGTGGACGTAGGCGACGTGGATGCCAAAGCCCAGAAACTGCTCGTTGGTGTGGATGAGAAGCTGAATCCTGAGGACATCAAGAAACACCTATTGGTCCATGCCCCTAAAGACAAGAAAGAAATTCTGGCCAGTTTTATCTCCGGCCTCTTCAATTTATATGAAGATCTGTACTTCACCTACCTCGAGATCAACCCCCTTGTTGTGACCAAAGATGGCGTCTACATTCTTGACTTGGCGGCTAAGGTAGATGCCACTGCCGATTACATCTGCAAAGTGAAGTGGGGCGATATAGAGTTCCCTCCCCCCTTTGGGCGTGAGGCTTATCCAGAGGAAGCCTACATTGCAGACCTGGATGCCAAAAGTGGAGCAAGCCTGAAGCTGACCTTGCTGAACCCCAAGGGGAGGATCTGGACCATGGTGGCTGGGGGTGGTGCCTCAGTCGTGTACAGTGATACCATCTGTGACCTAGGGGGTGTCAATGAGCTGGCGAACTATGGGGAGTACTCGGGTGCCCCCAGCGAGCAGCAGACCTATGACTATGCCAAGACGATCCTCTCCCTCATGACCCGCGAGAAGCACCCAGATGGCAAGATCCTCATCATTGGAGGCAGCATTGCGAACTTTACCAACGTGGCTGCCACGTTCAAGGGTATTGTGAGAGCGATTCGAGATTTCCAGGGCCCCCTAAAGGAGCACGAGGTCACTATCTTTGTCCGAAGAGGTGGTCCCAACTATCAAGAGGGCTTACGGGTGATGGGAGAAGTTGGGAAGACCACTGGAATCCCCATCCATGTGTTTGGCACAGAGACTCATATGACGGCCATTGTGGGCATGGCCCTGGGCCACCGGCCCATCCCCAATCAGCCACCTACAGCCGCCCATACTGCAAACTTCCTCCTCAACGCCAGTGGGAGCACATCGACTCCAGCCCCCAGCAGGACTGCGTCTTTTTCTGAGTCCAAGGCTGATGAAGTGGCACCTGCAAAGAAGGCCAAGCCTGCTATACCACAGGATTCAGTCCCAAGTCCAAGATCCCTGCAAGGTAGGACACCCCTGCCCCACCCAACTCTGCGTGTCGCTTGTTAGTGGGTTGCAGTCTTACCATGTGCTTTGTTTCCCCCTCCCCAGTGGGTTGCAGTGTTGTCTGGTATATTTCATCCCTGCCTTGGTGTGGCCTGTCCCCAAGTCCTAGTCTTTGCTTTCCCTTCCTTCCCACCCCCACTTAGTTTGCATCCTTCTCAGTGCTCTCCTGGCCTTGTGGCTGTCTCTGGCTCCACACTCAGGAGGTGGGTGGAGACCCCAGGCCCACAGCCTTGGAGAGGGGTGGTACCTAGGAGGGCGGGTCCTCCTGGGAAGGAGGGAGCCACTGAAACTGAAGGGGAAGTGGCAGAGCACAGTGGGGGAGGAGGGGAGCCACAGACCACCCCCAAATCTCATCAGCATCTCATGATGGCATCACTTTCTTACTTTGCCCACCTCAGTCTCACCACCACCAACTTTTTATCCCGGAGCTCCCAGTACCAGGGACAAGTTCAGATTTCTCTGGGTTTAGGTGGAAAATGAGATAGAAAAGGAGAGGGTGCCATGTAGAAGGGGACTGGGCTTTGTCTGGTGTCTGAGGTCACTGTTCAGGACAGTCATACACAGAACGCACATTCACCTGTTCAAAGCATCAAGACTTCTCTTTTACTTCTTGACATTTGTTCACAGCCGCAGGAGATTTCAACCTGGGGAAAGGGAGTCTTATGATGATATTCGACCCCTTGCAACTAGTCAGGAGTTGCTTATGTCACTCCAGAAAGGCCAAGAATGCAGCCCTTGGGCCATTTGGCAAGATCCATTGTTTCTTAAAAGGCTGACCTGTGGCTGAGCAATGTGCTAAGAGAATAGAGGCCACTCTTGATATCCCAGAGCTCCTCTACCTTGAGGGAAGGGTTTGTGCTTACCATCAGTCCCTGAGCTATGCTGAGAAGTGGGAGAGGAAGGACCAATTGTGCCAAGATAGGCCCTTCCCTCAACTCTAGAGGAGGAACCATGTGGGGAGCTCCTAGCCCCGGAGCAGGGTTTGTCTCTGGAGCTTCCCTGATGCTGGTGGGCTGAGGATCACCCCCATCTGCTTTGGTTCCTCAGTGCTAGAGGAGGTGAGCACTCTGGTTCTGCTGCTTTCATACAGAGGGTTGGGTGGGTTTGTAGAGATTCCAAGCCCTGTCCTGATTTCTGTAGCCTCTTAGGTGGACAGATGTGTGTATGTGCATATGTGCATGTGCTGACTCGGGCGTGGGCTCCCCCGAGGATGGGAGTGGTGGGGCCACGCCGGCTTATATTCCTCTTCCTCGCTTGCACAATTGAGCTGTAATCTACTGGCTCTGATGCTAGATGACCTAGGATCTCCGTCATTTGGCATTTCTGGGCTTCAGTTTCCTGGGACTGAGAAGTGAGGGCACTGGATTAGGTGGCTTCCCTTGTTCTATGATCTCATGTCTCGTCGGAACCCGGATGAGTCCAGTGACAGTAAATTCCGGGTATTTGCAACATCAGGAGCATGTATCATGAGTAGCTAATGGCTGCGGTAGAAGAGGCGGGCCTTTGGAGATGAGAAATCTACGTGCCTTGGGAAACTGAACTCTTCAGTTCACTTAATCAGACTTTGAACTTGGTAGCTAAGCCTGCACTAGTACAGTAGGTTAATTAATACCAGATGCCACTGAGCTCCGTGCACTGTTTTCCCCCTGGAGATGAGAGCCTCCCCTGAGGGCTACTTCCTTCCAGTGGGGCTTGCAGGAAACAGAAAGCAAGGTCACCTCCTTGCAGGATGGTACAGGGGTCTTTCCCTTCAAGGCTGAGGAATCCACTTCTGCCAGCTATTTTTGTTCCTTATTTTTGCCCCTCGCCCCTTCTGAGAGCTCAACCAAGAGCACTGTTCTGAACAGGAAGGAGCCACCTGGTGGAGGGAGGAGGTGAGAGGAATATAGCCTGCTGCTCTGGCCTGGCCCCTTGCCAGAGCCCCGGAGATAAGGGGAGGAGTGCCACCCTCTTCAGCCACCACACCAAGGCCATCGTGTGGGGCATGCAGACGCGGGCCGTGCAAGGCATGCTGGACTTTGACTACGTCTGCTCCAGAGACGAGCCCTCAGTGGCTGCCATGGTCTACCCTTTCACTGGGGACCACAAGCAGAAGTTTTATTGGGGTCACAAAGAGATCCTGATCCCTGTCTTCAAGAACATGGCTGATGCCATGAAGAAACACCCTGAGGTAGATGTGCTGATCAACTTCGCCTCTCTCCGCTCCGCCTATGACAGTACCGTTGAGACCATGAGTTATGCACAGATCCGGACCATTGCCATCATAGCTGAAGGTATCCCTGAGGCCCTCACGAGGAAGCTGATCAAGAAGGCAGAGCAGAAGGGTGTGACCATCATTGGACCTGCCACTGTTGGAGGCATCAAGCCTGGGTGCTTTAAAATCGGGAATACAGGTGGGATGCTGGACAACATCCTGGCTTCCAAACTGTACCGCCCTGGCAGCGTGGCCTACATCTCGCGTTCTGGGGGCATGTCCAACGAGCTCAACAATATCATCTCTCGAACCACGGATGGTGTCTATGAGGGCGTGGCCATTGGTGGGGACAGGTACCCTGGTTCAACATTTATGGATCACGTGTTACGTTACCAGGACACTCCAGGAGTCAAAATGATTGTGGTTCTTGGAGAGATAGGGGGCACTGAGGAGTATAAGATCTGCCGGGGCATCAAGGAGGGCCGCCTCACCAAGCCTGTGGTCTGCTGGTGCATCGGGACCTGTGCTACCATGTTCTCTTCTGAGGTACAATTTGGCCATGCCGGAGCTTGTGCCAACCAGGCTTCTGAAACTGCAGTAGCCAAGAACCAGGCTTTGAAAGAGGCAGGAGTCTTTGTGCCCCGGAGCTTCGATGAACTTGGAGAAATCATCCAGTCTGTGTACGAGGATCTTGTGGCCAAAGGGGCCATTGTACCTGCTCAGGAGGTACCGCCCCCGACGGTGCCGATGGACTACTCCTGGGCCAGGGAGCTGGGCTTGATCCGCAAACCTGCCTCATTCATGACCAGCATCTGCGACGAGCGAGGACAGGAGCTCATCTACGCGGGTATGCCCATCACTGAGGTCTTCAAGGAAGAGATGGGCATTGGCGGGGTCCTCGGTCTCCTCTGGTTCCAGAGAAGGTTGCCCAAGTACTCCTGCCAGTTCCTTGAGATGTGCCTGATGGTGACAGCCGATCATGGGCCAGCCGTGTCTGGCGCTCACAATACCATCATCTGTGCTCGGGCTGGGAAGGACCTGGTTTCCAGCCTCACCTCGGGGCTGCTCACTATTGGGGACCGGTTTGGGGGCGCCCTGGATGCAGCAGCCAAGATGTTCAGCAAAGCCTTCGACAGTGGCATTATTCCCATGGAGTTTGTAAACAAGATGAAGAAGGAAGGAAAACTGATCATGGGCATCGGTCACCGAGTGAAGTCGATAAATAACCCAGACATGCGAGTGCAGATCCTCAAAGATTACGTCAAACAGCACTTCCCTGCCACCCCCCTGCTCGACTATGCGCTGGAAGTGGAGAAGATTACCACCTCAAAGAAACCGAATCTTATCCTGAATGTAGATGGCTTCATCGGAGCTGCATTTGTAGACATGCTTAGAAACTGTGGGTCCTTTACTCGGGAAGAAGCTGATGAATATATTGACATTGGAGCCCTCAATGGCATCTTTGTGCTGGGAAGGAGTATGGGCTTCATTGGACACTATCTTGATCAGAAGAGACTGAAGCAGGGGCTGTATCGTCACCCATGGGATGATATTTCATATGTTCTTCCGGAACACATGAGCATGTAACTGAGCCAGGAACTGTGTTGCAGTAAAGTGAAGACAAGATCTCCTCCCCCCAGAAATAGTGTGCAGACAGCTGGCACTGGAGCTTGCTATAGGATGGGCCTGGAATATAAACAGCCGTTGGTATACAGGCACCGAAGACCAATACTCACAGGCTAACACTGTTTAGTCCACACAATGAAGCTTAATATTTTTTTTATAAGCATAGAAATAAAAACCAAGCCAATATTTGTGACATCTGCTCTGCCACCTGCTGTGTTTATTATATAAAAGCATCTAAGCACTGTCAGGATGGCATTTTTCCTTATTATAGGGCGTTATAATGTTGCTTTCTTTTTTCCGTTAGTTAAAAATTTTCCCTTGGAGGAAGGGAATGAAACTTTTAAGACTTCAAGATATTATACATTTAAAGCATCCCTAATGTCTTGTTTTCCTGCTTATATAACCTGAAGAGCATTGTATTAATCTGATTTTTTTTTATGATCTTTTTGTATGTTATGCGTGAAGGATTTGTTCGGTATCTCACTGAAACATTTCATGTTGTAGACTAAAGTCTGCTTCTGTCAGGGGGATTGGACCATTGCATCCTTAGCCACTATCACAAAATATGTGGAATAGTGATTTAAAATGTAAAGTTGCAACATACATGTTTAAAATGGAAACACAAAGAAAAAGCTGTGAAATGTCTTGTGTCTTATGTTCTCTGTATTTATGCAACTGATCTGTCTTACTGAAGTCTGGGTCCAAGGACTCATCTCCAACCAGTTTGCATCTGTAATCCACAAAGATTCTGGGCAGCTCCCACCTCAGTCTCTTCTCTGTATTATCATAATTTGGTTTAAATAAACTATATAGTAACAATGAA