Transcript asmbl_248736

Sequence
Transcript Sequence for observation asmbl_248736 of TGE0072989:
GGGCCGCAGGCGCGCGGTCGCGGAGTGATGACGTATCCCCGGCGTCCCGCACTGAGTTGACTGAAGCGAGCATGTGGGTCTGCTGCGCGCTGCGCTGGTCGCGAACCGCGGCCCGGCTGCGGCCGGGGCTGCTGCTCTCTGCGGGCCGCTGCTCGCCTGCGGCCGCCTCCTACTCTGCTTCTGCCGAGCCCTCCCAGGTCCAGGCGCTGGTCTACGAGCACCACGGGCACCCAACCAAGGCCATCGAACTGAAGAACCTGGAGCTAACTGCTGTGGGCGGATCAGATGTCCATGTGAAGATGCTGGCGGCCCCTATCAATCCATCTGACATAAATATGATCCAAGGGAATTATGGCTTCCTTCCCAAGCTACCTGCCATTGGAGGAAACGAAGGCGTTGGACAGGTGGTCGCAGTGGGCAGCAGTGTGACTAGGGTGAAGCCAGGAGACTGGGTGATTCTAGCACATGCCGGTTTGGGAACCTGGCGGACCGAGGCTGTGTTCAGCGAGGAAGCACTGATCAGAGTTCCGAGTGACATCCCTCTTCAAACTGCTGCCACCCTGAGTGTCAATCCCTGCACAGCCTACAGGATGTTGATGGACTTTGAGCAGCTGCAGCCAGGGGATTCTGTCATCCAGAATGCATCCAACAGTGGAGTAGGGCAAGCAGTCATCCAGATCGCCGCAGCCCTGGGCCTGAGGACCATCAATGTGGTCCGAGACAGACCTGACATCCATAGGCTGACTGACAGACTGAAGAATCTAGGGGCTGAGTATGTAATCACAGAAGAAGAGCTAAGAAAACTTGAGCTGAAAAACTTCTTTAAGGATGTGCCCCGGCCCCGGCTTGCTCTCAACTGCGTCGGTGGGAAAAGCTCCACCGAGCTGCTGCAGCGCTTGGCGCCCGGAGGAACCATGGTGACCTACGGGGGCATGGCCAAGCAGCCCGTCATCGCTTCTGTGAGCGTGTTCATTTTTAAAGATGTCAAACTTCGGGGCTTTTGGCTATCCCAGTGGAAGAAGGACCACAGTACAGACCATTTTAAGGAGCTGATCCTTACACTGTGCCACCTCGTCCACCAAGGCAAGCTCACAGCCCCCACCTGCTCCGAGGTCCCACTGCAGGACTACAACCATGCCTTGGAAACCGCAATGCATCCCTTCACATCGTCAAAGCAGATTTTCATCATGTGATAATAATCCCAGAGGAGCCAGAGCAAAGTGCGGGGCAGGGGGCAGAAGGGTGTGGGGGCGGGACGGGTCAGCAGGACACGTTTTGGCTCCTCAGTCAAGGCTCTTGACATTCCCCAGGCTGCTCCTCTCCTCAATGTCTGTTCCCACTAGAAGAGCTGTGAAGCCAACCAAGGCTTTCCCCAGGGTCAGCCTCGGGATATCTAATAAAGTCTAAACTTCTTAAACACAACAGACAAAAACCAGTAGAAGTCATCTCTGTCGAAAAGGACTATCACCGCACACCTGTCATCTCCCAGGACTAAGAAGTCCCCCTTCTTGCCTGTCCTCCATTCGTCCCTAGTAATCATTTCCTGATACCCTGAAGGCAAAGCGGGGGTGGGCCTGGCAGGTACAAAAGCCAGTGAGACACGATTTCTGCCCTCAAGCTGCCCAAGCTCACAGAGGAGAATCTTCTGAAAAAGGAAGGTTTGACTCATTCTCAAGTGGTGCCCAGCGCAGTCTGAGGCAGGAGGAGGATCCGCCGTGCGTGGGAGTGAGTGCCATGCTGAGAAACCAAGGAAATGTGGTCTCAGGAGACGGGACCACCCCATGGAACATCCGTTCTCACTGAGGAGACATGTTACACCGGTGGTTCTAAACCTGAGGTCATTTTACCCCCGGGGGACATTTCATAATGTCTGGAGACATTTTTGGCTGCATATTGGAGAGGGTGCTACTGGCATCTAGTGGGTAGAGGTCAGCGATGCTGCTAAA