Transcript asmbl_241968

Sequence
Transcript Sequence for observation asmbl_241968 of TGE0007215:
GGCGCAGGCGCGGCGCGGCACCATGCCCCACCCACTCGGCGTATGCCCCGCCCACCGGAACCCCGGGGCCGGAAGCAGGAAGAGGCGCAGGCAGAAAGCGGGCGGACGCGCTTTCCTTGGATTGGACAGGGGCGTCTTTCGCCCCGCCCCTCTTGCTCTTCTGCGGCCAGGAGGTGAAGGGTCGGGCCCGCGATTAGGTCATGGCGCTGGCCGCTCGACTCTGGCGCTTTCTCCCTTCGGGACGCGGCACTGCCGTGGGAACTCGGTTTCTGACGGGTGCTGCTGGCAGCCGCGGGACTTGCGGGCCTGGGCGACTCGGCGGCTCTGAGGTGATGGGAAACCCAGGAGCCTTTAAAAGAAGCCTCATATTCTCAGCCTTGTCTTATTTGGGTTTTGAGACTTATCAAGTCATCTCTCGGACTGCTGTGGTTCATGCCACAGCCAAAGTCTTGGGAGTTGAAGAAGTCCTTGCACAAGCAGACTACCTCTACGAAAGTGGAGAAACAGAAAAACTTTATCAGCTGCTGACCCAGTACAAGGACAGCGAAGATGCAGAGTTACTGTGGCGTTTGGCACGGGTGTCACGGGACGTAGCTCAGCTTAGCAGAACCTCGGAAGCGGAGAGAAAGCTGCTGGTGTACGAAGCCTTAGAGTACGCAAAAAGAGCTCTAGAAAAAAACGAAGCAAGCTTTGCAGCTCATAAGTGGTATGCCATCTGTATTAGCGACGTTGGAGATTACGAAGGCATCAAGGCTAAGATTGCAAACGCCTACGTTATCAAGGAGCATTTTGAGAAAGCAATCGAACTGAACCCTAAAGATGCTACTTCAATTCACCTAATGGGCATTTGGTGTTACACGTTTGCGGAAATGCCTTGGTATCAGAGGAGAATTGCTAGAATGCTGTTTGCAGCCCCGCCCAGCTCCACCTACGAGGAGGCCTTGGGCTACTTCCAAAGAGCAGAGCAAGTGGATCCGAACTTCTACAGCAAAAACTTGCTTCTCCTGGGAAAGACGTACTTGAAGCTGCACAACAGAAAGCTCGCTGCGTTCTGGCTGGTGAAAGCCAGGGACTACCCCGCACACACCGAGGAGGACAGGCAGATTCAGATGGAAGCCGCTCAGTTGCTTACAAGTTTCAGTGACAAGAATTGAGAATTTTTCAGAGAAGAAAACACATGAAATACCTAGGAACCACCACCTTTTCATCAAATTACAAGTACATTATAACTGTTCTCTGTCTGTTTTCTTGGTTCTTTTAATGTATTTCACAAATCACAAAAGAAATAATTGCCGTGAGCGTGGTCGGGCTGTCTCTGGCTCAGAGACTACTGTGCATTGGGGGCCCCAGCAGTGCAAAGTGGGATCAGATTTGAGGACTGGTCCCATCAGGCTGGGAGGGGATCAGGAAAAGCTTTGTGGGGGAGGTGGCAGTGGGGACTGCATTGCAAGCTGGATGGAGTCAAAGTTGAAATCTTGTCGAGATGGCGAGTGGCAGTCGGGAGGCTGGGAACCAAGGGATTAAGTGATGTGTCTTGGAGCCAGCCTTGTCAGGAGGACTGGGAAGGGACTTGATTTCCTTGTCCCTGTGACTCCACCTCACGGGTGGATTTGTGTCTGGACAAAGCCCAGATCTGGTGCCCTGACGGGGTGGAAGGGAAACCGTGTGGCTTACTGGGGGGGCCGTCAGCACTGCCGACTCGGAGGCTGTGAACAGGAGGACCTCAGACGCCACTTAGATCTGAGTGTACGTGTGTGTGGCCTCTCCCCAGAAGGGGCGGGAAGTGTGTCCCGGTGAACCGCGTGGGTGTGTGCTGTTCGATCATGTGTGTTTTCCAGCAAAAAGGAAGACTGGAGTCTGCACACCTGTCTGATTCACACGTGGACGTGTAGTCTCAGAATTGTAGACAACTCATTTCATCCCTACATACCTGAGCACGCACTGTCTCACAGTAAGGACATCCTTCACAAATCCGTTGTCACCGCTGAAAAGTTAACAGTAGTAGTTTCTCGAATGTCCCAAAATGTCTGTTTTTGAAACCAGGATCCAAACATCATAACGCTGCCTTCGTTTGAAATCGGAAACAGTTCCCCCACCTTTTTTCTCACAGCATTGACTTTGTGAAGAGGCTGGCACAGCTGGCTCAGATTGTCCCTTTTCTAGGTCGGCCGTACGGGACACACCTGGAGACCCCCTGCTCCGTGGCTCAGATTCCAGTGAATCGCACGTGCAGTAGATTTTCTCTAACTTACATTTATCACTTTCTGGTTTTTCTTTTTACTTTTTTCGGTTTCATTTTTTGGCTCGCTTCATTTCTGTCTCGTGTCCCTTTAGTTCTAGATCGTTTTCCTCCTTAGGAACCTTTCGCCTTCACTGCTATTTGTCGTATTTTTCCTGATTTGTCAGCAGACATTTCACATCTTTAGATGGTTATTTGTCCAATTCTGAGTTTTGAATTGTTAATTTGGATTTTTTTCATATCTATGTTTATGTACATTTAATACATGTTAGTGTATGGTGTTAACAAATTTTTGCTGTTTTTTGTATTTTGAACATTTTGATCTGAAATTTCCTCATTTTCAGTTTTCTCTTGAGTGACTGTGAACGTCGTTTCCTGGACGTGTGGTTTCTGGGAGTGTGGTTACCATCAGTCAACACCAGGCCGTCACGTGGGACGCGAGGGGTTTGGTTTAGTTCAAGAGCCTCTGCTGAGTGGTTTCTGTGGAGCGCGGTGCCTTGCAGTGGTGAAGCCTGTCGTGGAGGCGAGGGACCGTCCTCCAGTAGAACAGGGGGGTCCTGTGTGTCCGTCCCGCTTTGCCCCGTAGTGACATGTAACTATATTACGATTCAGGTGTCACCACCTTGGGTGCTGTCGTGCGTGCGCGTTCTGTGCAGCTCGATCACACGAGCAGACTTGTCACTGCCACCACGGTCGGGACACAGCTCTTCCATCGTCACCGTCTCCACCCCCCCCC