Transcript asmbl_241822

Sequence
Transcript Sequence for observation asmbl_241822 of TGE0007200:
CTTCGGCTGGCGCCTCTAGAGCCTCCAGAGCCCGCGGGGCTATTCCTCTTCCGGGGCAGCGCGGGGACGCGTGTAGGACCCGGATGCAGACGCGAGCACAGGTTTATAAGCGCCACGCAGGCCACGGTCCCTTCTTTTGGAGGAAGACGCGGTAGCAGCTTCAGCTGCGTTTCGTCTTGCTCGCTGTTGCTCCTGACTCACCGCTGTTCGCTCTCGTGGAGGAACAAGTCGGTCAGGAAGCCGCGCTGCAGCCATGGCCTTTAAAGATACCGGAAAGACGCCCGTGGAACCAGAGGTGGCGATTCACCGAATTAGAATTACTTTGACCAGCCGCAACGTAAAATCTTTGGAGAAGGTGTGTGCTGATTTGATCAGAGGTGCGAAGGACAAGAATCTCAAAGTGAAAGGACCAGTTCGGATGCCCACCAAGACTCTGAGAATCACTACAAGAAAAACTCCCTGTGGAGAAGGTTCTAAGACTTGGGATCGTTTTCAGATGAGGATCCACAAGCGACTCATTGACTTGCACAGCCCTTCTGAGATTGTTAAGCAGATTACTTCCATCAGTATTGAGCCAGGAGTTGAGGTTGAAGTCACCATTGCAGATGCTTAAATCAGACTTTTTAATAAATTGACTATCAGTTAAATTTTGTTGACTTTTATTTGCAGTAATGGCACATTTTAAGACTATAAATTTAGACTGAATTTACTTTCAAGTAGAATAATCAAAATTAGTTGGATATGCTGTGGTAACCTGTCCTGTTTTCATTATATTCTGTTGTAGAGTCTGCTAAACCAGTTTATACTTGGAATCACAGGACAGCTGGGTTCTGTTAACTAAATACATGAGACCTGACCGTTGATGAATGTATAGTGTGGTGGCTTTATAACTGGCTGCATATTGGGGCTTTTTCAAAGAATGCATGTCTGGGTCCTATCACAAGAAATTCTGACAATTGATTTGGGGTTCTGTCCTATAACACAAACAGTTTCTGGGGTGATTCTGAAGTTCTATGACTGGTTTAGAGCCTGGCGCGTTAGAGGACAAGTAACTGGGAAAACAAGTTCTACCCCTGGCTCTGCAAATAAAGTCATCCCTCCTTTTTAGAAGATACATAGCTAAAGAGTAAACAAGGCAAATTTTAACAGGTTTTGGCAACATCGGTTTTACATATATTTTAGATTAAAAGGTAAAAGTAAATACTAGTACTTTGCTGATAGGTTGTATCTAGACTTGTATTTTATATACATTACTTGGAATTTTAACAATGTGTAGGTTATTCACTATGAAATTCTTAACTTTAGGACTGAAAAGCATGTCACATAGGCCAAATTCATTCAGCAAAACTTCTGTTGGCACAGTGAATAATATTAACTACCAGGTTGTATGCTTAAATGCTTTATTTTGTTGAATTCTATTCCTATTATGTAGATCCAGAAATTGGCTTAGAGTTTTAACTTGCCCATTGTCCTAGAGCTTGAAACCATAGCTGAGATTTAAACAGGTATACAAGATGAGAATCCATCTTTTGATATCCCATTAAAGTATTGAAAAGTTTTTGCTATAGAATATGTAATCGAATGTTTTTCTGGATATGTCTTTAGAGAAATTTTTCAGAAATACATCTGACAAAAGTAAACATTTTTACAAATAATAGTCCCTTCAGAAGATTAATGCTCTCACATTAGCTGTTCTTAATTGTATTAGTCATGAAATTCATGCCTTTACACTGGGTTTGTGCTTAAGCTTTCACTGGATTATTTTGTCCACTGGCTTCAGTTACCACATACATTCAAATTGACATTTGGCCCAGATTTCTCTCTATACTTTCAGTTGTGTACTAGACTTGCGTAGCTTACACAGCTCCAAAAGCTGACACATCCAAAATGGAGTCCTCTCTCCCAAAACTCTCTCGATTCATGGTCTGCCATGCAGCCACACAGTCAAATATTGGAATTATCCCTATCTCTTCCCCTATTGCTCCTTTATAACATCTGCATCCTTTTGAGTACCTTTTTTTCTCACACTTCCAAAACATTTTAAACATTAAGAGATTTGAGTGGAACTGAATTTGGAAAGAACTGTGCCAAGTTGCTGGACTCAAAATCTCAAGTAGTTTTTAAATACAAACTGGAATCAAAGTTTTGAGGTTAGCCAATTGAAACAGCATTATACCAAACCAATTTTAATTAGCTTAGGAAACTAATAACTAAAAATTTCATTGTAACTGATAAACATCGGCCTGTAAGCAGTTAAAGAATTACATAGTGTGAGTCTAGTTAGGTTCCTGAGGCCTGCAGTGATTCATTCTTTGATAGAGAAGTTGGTGCTCTTGGGTTCAACTCTAGAAGAGGAATTATTAATTAAAAGCCAGTTAGTGAGCTATTAGTCTTTAACCCCGTTTTAAATATTTTCTACACAAGTGTAAGGAGCACTGCTTAGGTAGCAATTCAGATCATTTTAAAACATGAATACCTAACAATATATGGCTGGCCCCCAGACACAAGTACCTGGTCATGTTTTAGTGAACTAAGTATATTGTAACAACTCAAATACACTCAGCGTTCTGACACTTGGTTGAAAAAATCTTAAAATTCTGTGAAAGAAAGCTGTTTATGACTAGGTTATTTTGAGAAATGTGCCTCAGTAAATCAGAAGGTACTGAAAGCACAGCTTAATGGCTTTCATTTATCTACTTGGAAATAAAAACCTTGCAAGGCCTTCAAGCCTTCAAATATTGTTAGGCTAAATAGAGCTGTGGTGCCAGTGATTGAGTTAGGCCAGCTTGTCTGGATTGGGAGGTAAAGGAAAGTTGAAAATGGGAG