Transcript asmbl_59259

Sequence
Transcript Sequence for observation asmbl_59259 of TGE0006588:
CCCATCCCTCTTTGTGTGTTTCGGGAAGCCGCAGAGCTAGTGGCGGTGACTCTTGGCATTGGGGGTGAAGGAAAGGGACGTTACAGGGAACTTGCAGGCGGCAGGACTCTTCTCCATCCCGCCACTTGACAGGTCACAAACATGTCAGACAAAAGTGAATTAAAGGCAGAGTTGGAACGGAAGAAGCAGCGGTTGGCCCAAATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAGGAAACTGATCAGAAGAAAGAAGCAGTTGCTCCTGTACAAGAAGAATCAGATCTCGAAAAAAAAAGAAGAGAAGCTGAAGCACTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTGTCCCTCCTCCTATGTCTCCATCCTCCAAATCTGTGAGCACACCAAGTGAAGCTGGGAGCCAAGACTCTGGAGATGGCGCAGTGGGATCTAGACGAGGACCTATTAAACTTGGAATGGCTAAAATTACACAAGTTGACTTTCCTCCTCGAGAAATCGTGACATATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCCAAAGAAGATGAAGAAGAAGAAGATGATGTGGTGACTACTAAACCACCTATTGAACCTGAAGAAGAGAAGACTTTAAAGAAAGATGAGGAAAATGACAGTAAAGCTCCCCCTCATGAGCTGACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAAGAATTTTTAAGTTTCTTTGACCATTCTACACGAATTGTAGAAAGGGCTCTTTCTGAGCAGATAAACATCTTCTTTGACTACAGTGGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAATCGACAATTTTTTGATGAACGTTGGTCAAAGCATCGGGTTGTTAGTTGTTTGGATTGGTCATCTCAGTATCCAGAGTTACTCGTGGCTTCATATAATAACAATGAAGATGCTCCTCATGAGCCTGATGGTGTGGCCCTTGTATGGAATATGAAATATAAAAAAACTACCCCGGAGTATGTGTTTCACTGCCAGTCAGCTGTGATGTCTGCTACATTTGCAAAATTTCATCCAAATTTGGTTGTCGGTGGTACATACTCAGGCCAAATTGTGCTGTGGGATAACCGTAGCAATAAAAGAACTCCAGTGCAAAGAACTCCACTGTCAGCTGCTGCACACACACATCCTGTATATTGTGTAAATGTTGTTGGAACGCAAAATGCTCATAATCTGATTAGCATCTCTACTGATGGAAAAATTTGTTCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAATTGGTTCATAAACAGTCAAAGGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTTGTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGTCGCCATGGCAGCAAAGCTGGAATCAGTGAGATGTTTGAGGGACACCAAGGACCAATCACTGGCATCCATTGTCATGCAGCCGTTGGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCATTTGACTGGACAGTAAAACTTTGGACAACTAAGAATAACAAGCCTTTATACTCATTTGAAGATAATTCAGACTACGTTTATGATGTTATGTGGTCACCCACCCACCCAGCCCTCTTTGCCTGTGTGGATGGCATGGGGAGGCTAGATTTGTGGAATCTCAATAACGACACGGAGGTGCCAACTGCCAGCATTTCCGTGGAGGGTAATCCTGCTCTTAATCGTGTAAGATGGACCCATTCTGGAAGAGAGATTGCCGTGGGTGATTCTGAAGGACAGATTGTTATATATGATGTGGGAGAGCAAATTGCTGTCCCCCGAAATGATGAATGGGCACGGTTCGGCCGAACACTTGCAGAAATTAATGCAAATCGAGCTGATGCAGAGGAGGAGGCTGCTACCCGAATACCTGCGTAGCTCCTGAAAATGGGATATGTAGCCTTAGTGGATTTGGGGAAGACTTTAAGTAGATCCTGAGACTATTTGCATGCTTCTGTCTAAATGATAATTAAAAGGAACTTTGGTGGATTAAACCATGGATTTAATGCAGCAAGCAATTCTTACAATGTCCCTTTTTATATAACATGCATCCTGTTTTGGATTTATGTCATTTTTAATACAGCTTATCGACTTTACTGAATGCAGCCTCTTTTGAATTCTTATACACAGGTGTATATTTGGTATTAGTTATTATTTTGAATTATTTTCAACTTATAACACTATATACAGTTATTTCTAAAGCACAAATTAAATAACTTCTGCATATTTTTAAGTAATCATAATTCCCTGTTATACTGATAAAGTTCTAACTTAATATGTGGGAACATTGTTCATTCTTAGCCATAGCATGCATACATCTATCCAAGTTATGTTCTAATATCTTTTTTCTTCTTTATAATTCATGTGATAGCTGTATATAAATAAAAACAAATATGATTTAACTTTTCAAA