Transcript asmbl_241299

Sequence
Transcript Sequence for observation asmbl_241299 of TGE0000273:
AGGTACTAGCTTTTGACAAGTTTGCACCATGCGTGAATATAAGCTAGTCGTTCTTGGCTCAGGAGGCGTTGGAAAATCTGCTCTGACTGTACAGTTTGTTCAAGGAATTTTTGTTGAAAAATATGATCCTACGATAGAAGATTCTTATAGAAAGCAAGTTGAAGTAGATGCACAACAGTGTATGCTTGAAATTTTGGATACTGCAGGAACGGAACAATTTACAGCAATGAGGGATTTGTACATGAAAAATGGACAAGGCTTTGCGTTAGTTTATTCCATCACAGCACAGTCCACATTTAATGATTTACAAGATCTGAGAGAACAGATTCTTCGAGTTAAAGACACTGATGATGTTCCAATGATTCTGGTTGGTAATAAGTGTGACTTGGAAGATGAAAGAGTTGTAGGAAAGGAACAAGGTCAGAATCTAGCAAGACAATGGAACAACTGTGCATTCTTAGAATCCTCTGCAAAATCAAAAATAAATGTTAATGAGATCTTTTATGACCTAGTGCGGCAAATTAACAGAAAAACTCCAGTGCCTGGGAAGGCCCGCAAAAAGTCATCATGTCAGCTCCTTTAATATACTAAATGCATTGTAGCTCTGAGCCAGGTCTGAGGAATTGTTGCCCAATTCAACAGTGCCAGCATTCCAACTTTGTTAAACCTACCAACATCTTAAATGGACTTTCTGTGGTGGTACCCTTTAAGAGGCGGATGAAAGCTACTACATCAGTTTGCACATTCTAATCACTTTCCAGTATCACAAGAGAGATTTTTACTTACATAATAGTCCTAGAGTATGCAGCTGGTAAAACCAGAGGCTACAATCCAGTATTACTGCTAAGAGACATTTTTCATCCACCAATGTTGTACATGTATGAAAATGGTGTACTGTATACTTTAACACGTCCCATACTTTGTATTGGAGAGTACAATAATGTAAATCCTAAAAGCACCACTATTTTAGCATAATAAAAGAAAGTCCAAAGAGCTCCTATATAGACTACTCCAGATAACTTTGCTTCTTTGATACTTGTAGCTTATTGTAATTTTTTTTAAGAAATTCAAGGTCATTATCATTGTATTGTACAAATAAGCGCTTTGATTAACACAGCTATATAGTTTTTTTAATTTTTAAAAAACCTGTGGAGACAGTGATCTTGTCTTTAAAATATGATAGTCCTTTCAGTATAATGTCTTAGGTTAAAGACGTTGCCTTTAATATCTGTTGGGAAGGAAATGTCCAGACTTTTCAAATCTCTTATTATATGTTTCCTTTTTGTTTACATAGGGAACAATGTTTATAGTTGTGTGTACAGTGGGGGTCTACAACAAGAAGTGTATATTTTCAAACAATTTTTTAATGATTTAACAATTTTTGTAAATCATTTTCAGGCTTCTGCAGCTGTAGATTCTCACTGTGAATCCCTTGCTTGCTCATGCATAAGTGTATTTGCAATACCAAATATACAGGTTTAGTATTTTTGCCTGTTAGTGATTGTTTCACATGTGTAACGTTTTGGTTGAGATGTTAAATGGTGGACGAGTACTGTGGATGTGAATGTGGGAAGTAATTTTAATCATGTGTAATTGGTCACAAGGCCTAATTTGCAGTAACTATTGCTGTTTTATTTAACAATGCCTTGTTGCTTTGTATGCATTAACGTTTGGGTGTAAAGATTGTGTGTCTATCCAACAGGGAGCCACAGTATTTAAATTGACCAACCTAATGTTACAACTACTTTGAGGTGGCCAAATGTAAACTAAAAGCCTTAATTAAAGTGGTGCAATTTTGTATGACTTAGCATCAGTAGTTCAATAAATTTGGATTGCCATGCAAGGGCTTGCATTATAATTACTTGCCACTTGAATGTGTTTTCTGTAATGTTTAACAGTGCTAGTAAATAAATATAGGCTTAACTTTTTCAGTGTACTAGGTGCATTTTACATAGTGTGGTTTCATAATTTAACATTTGGGCAAGCCAAACTTATTAAGTACAGAAATGATGAGTGAAAGATGTCATGTTTTTATCCTAGTATTGTTTGAATATCCACATAATCACCTTTTGAGTTTTTCCTTGGCAAAGAATTTTGTAAATCAAGCAAATTACTTAAGAATATATGCCTTCTGGGTAATGTTCAGTAGCTCTGAGCATAGGAGGAGAATTAAAATACTTTGACAGATATTATGCTTATGAATTTTTAAAAGATACAGGATAAAGTTCGAATATTATGGTTACAAGCCTTTTTGAATGAGGTTGACTCAAAGTACTACTTTCTTTTTAGATAACAGATCTGCCTTTGTCTATGTGTTCTGTAATTCAGTTCTTTTTTGAAACTTGTAAACAAATCTTGACTCAAACTTTGTAAGTATTTGCCAGCCACTGGAGCATAGCAATTAATTCGTGGTAACATCTAGCTTAGGGGGCCTACTAATCCCCTAAATACATGCTATTTGAATGGGATACTTAAAGTCTTTCATTTCAAAAAGAAAAAGGTCTCCTTCCTTATGTATTTCACTCGCAGATTCATGTATTTAAAGGTTCCATGTATCTAAAAAAAAAAGGAATGTTTGTTTTCTCAGAAGTCCTACTTACCGAAGAGACTCCCTTTGGCAAAACTGGTTTTATTTAGAGCCATTGAGAGAAAATTAAACCCCCAAAAAGTGGGATTGTGGAACACTGAAATTACTTCGATTTACTGTCCTGTTACATCCATTTGACCCTCTTTGAGGGCACCCCAATTCAGTTATCTTTGATGTTTGTTGCCTACCAACTATGTACCAATCTGAGTTCTAGGCTCTTAAAAACAAAAATATTCAGCAGATAAAATTTAAGTACTTCTGTGTCAAGCATTGTTCTGGGTCTGAGGATAGAGCAGCAACTGAGATCAACTTAGAACCATGCCCTCCTAGAATTTATACTCTACTGTAGGATTTCTCAGCTGTAGCATTATGGATGTTTTGTACTGGATAATGAGTTGAGGGGGTAGGGCTGCCCTGTGTGTTACAGGATTTTTGTAGCATCCCTGGTCCCCAGCCACTCATTGCCAGTCATACCTTCCCCACCCTCCAGTTGTTTCAACGAAAATTGTCTCCAGACATAACCAAGTGTCTTCTAGCAGATTCAGAGACGGGCAGAGTGGGTGTTGAAGGGCAAAATCACTCCAGTTGAGAACCACTGTTTTAATTACAGGTGAATGTTAGGGGTACAAATGGACAGTTTAGTATAGTGAATAAGAGCATGGGCTCAAACCAAATTTCTGGGGTTTCTAATCCCAGCTCTGCCACTTCCTAGCATGTGACCCTGGTTAGGTGCCTTGATTTCTTTATCTGTAAAATGGGAATGATAATATAACTTGTTATTAATTAAAGAGTAAAGTAAATGCCAGTACCATCCTCTAGATCAAAAAATATATATTTCGATTCTGTATTTTACTAATAGAAATAGGGCTGTGGTTACACAGAAAGTACCATTATCTCCCATATAAAATAGTAACACAACCTTAGGAATGTAAATTATATGTAAACGGACTTTTCTGGTGCTTTAATGGAAAAACACTAAAATAATTCAGTCAGAAAACTCACGAGTTCCTTTTCATCGTGTCCCCAGGCAGGGATACTTGGAGAAACTTGAATTTTAGGAGAAAACCAGAAGGATGTTTCACTTAATTTTTCTAAGAAGTATAAAAACCCTATTTTGACTTTCATGTTTATCCACCTTTCTTAAATATGTAGTCTTTACCACATATATATTATAAATACAAAGTTTTAAAACTTCCATTTATGAAAGTAAGTTTTTCTTTGCTTTTTTAATCATCCTGATTAGATGTGGGGTAGCAAACTTAGAATCAAAACTCATCGCTGCAATATTTTTTTTAAACCTCTGTTTATTCATTGAATTTAATCCCCATCTGTTCTTTCTCCTCTCTTAAATCTTGGAAATGTAGAAAGAAAGGAATTATAGTATTTTATAATTAATACTTTTTCAACTTTATCTTAGAAATCTTAGTGTTTGCAGTCTTCTCTTAAACTATCAGTAAGCCTTAACAAACTATGATTTATAGGACCCAAACTTAAAAATCTGTTCCATATTTTGTTACAGTGCATCAATACAGCTGGTATTTTATGCATGCATGAGAGAAGTGTAATAAATTGAGACTACAACTAAACTTATGTTCCCTGAACATGACTGTTGAGAGAAAAGTACATGAGTATTTGTTAGGATGGATATTGATGATACTTGTCAAAATTGGCTATGAAACCTGTTAAAGGAGCGATTGAATTTGTAGGCTTGACATTAGTTTATCTTTGAAAGGTAGAAATAAAATATTTACTGCTAAACAGATGTTTCCTAAATGTTGCAGGTTTTTAAAAAAAATCTTTTCCACATGTTGCACATAATTTGAACTTGCTCCTTTAAAACATCCTTGTTAGTGGCC