Transcript asmbl_238125

Sequence
Transcript Sequence for observation asmbl_238125 of TGE0072884:
CTTTCCTGGATCTGCCCGCCTGGCGCCCTCCCTTGCTTTACATCCACTCCCCCCCCCCACCTCCTGGCTCCCCGCGCGCCCTTTGCCCACCCACTCTCACCCCTGGGCTCTGCCCTCTACGCCCAAGGCCTGAGGCAGGGGGGACAAGCTTGCAGCCCGGAGCGCAGAGCAGGCGGGAACCAAGACGCGCGCCTCAGCAAAGCCCCGGACGGGCTGGGGTGCACGGGGGAGGGTGGGGCCCGATCCGCGGCGGCTGGGCAGTCCTCTGCCCCGCTCGCCACTCCCGCCCCCACCCCTGTGAGTGTGCGACGGCCCCTTTAAGAGCGGTGGCCCCTCCTTCCATTCCCAGGACCTATTAGAGCGATTGCCCAGACGCCGGTGACTCAGTGTTCGCGGGAGCGCCGCAGCCACACCAGCCAACCCGGATCCTAGGTCTGACAGCGCCGGCCCGGGTCCCCGCCTGCCAGGAGTAAGCCGACAGGCGGCCGGCCCCGCGTGTCCGACCCAGAGCCACCTCTGTCCTTCGACCCGAGCTCCGCGCCCTTCCTGCGATCCCTGCCCCGCGGGCAGCGCTGCCATCCTGCCGGCCATGGAGACTCCGTCCCAGCGGCGCGCCACCCGCAGCGGGGCGCAGACCAGCTCCACCCCGCTGTCGCCGACCCGCATCACCCGGCTGCAGGAGAAGGAGGACCTGCAGGAGCTCAACGACCGCTTGGCGGTCTACATCGACCGTGTGCGCTCTCTGGAGACGGAGAACGCGGGTCTGCGCCTTCGCATCACCGAGTCCGAGGAGGTGGTCAGCCGCGAGGTGTCCGGCATCAAGGCCGCCTACGAGGCCGAGCTCAGCGATGCCCGCAAGACCCTCGACTCGGTGGCCAAGGAGCGCGCCCGCCTGCAGCTGGAGCTGAGCAAAGTGCGCGAGGAGTTTAAGGAGCTCAAAGCGCGCAATACCAAGAAGGAGGGTGACCTGATGGCCGCCCAGGCCCGGCTCAAGGACCTGGAGGCTCTGCTCAACTCTAAGGAGGCCGCACTGAGCACGGCCCTCAGCGAGAAGCGCACGCTGGAGGGCGAGCTGCATGACCTGCGGGGCCAAGTGGCCAAGCTCGAGGCAGCCCTGGGGGAGGCCAAGAAGCAGCTTCAGGACGAAATGCTGCGGCGGGTCGATGCCGAGAACAGGCTGCAGACCCTGAAGGAGGAGCTAGACTTCCAGAAGAACATCTACAGCGAGGAGCTGCGTGAGACCAAGCGCCGCCACGAGACCCGGCTGGTGGAGATTGACAACGGCAAGCAGCGGGAGTTTGAGAGCCGGCTGGCCGACGCCCTGCAGGAGCTGCGGGCCCAGCACGAGGACCAGGTGGATCAGTACAAGAAGGAGCTGGAGAAGACCTACTCTGCCAAGCTGGACAACGCCAGGCAGTCGGCCGAGAGGAACAGCAACCTGGTGGGGGCCGCCCACGAGGAGCTGCAGCAGTCCCGCATCCGCATAGACAGCCTGTCCGCCCAGCTCAGCCAGCTGCAGAAGCAGCTGGCAGCCAAGGAGGCGAAGCTGCGGGACCTGGAGGACTCGCTGGCCCGCGAGCGTGACACCAGCCGGCGGCTGCTGGCGGAGAAGGAGCGGGAGATGGCGGAGATGCGGGCGCGGATGCAGCAGCAGCTGGACGAGTACCAGGAGCTGCTGGACATCAAGCTGGCGCTGGACATGGAGATCCACGCCTACCGCAAGCTGCTGGAGGGCG