Transcript asmbl_238123

Sequence
Transcript Sequence for observation asmbl_238123 of TGE0072882:
CGCAAGCTGCTGGAGGGCGAGGAGGAGAGGCTCCGCCTGTCCCCCAGCCCCACCTCGCAGCGCAGCCGAGGCCGTGCCTCCTCCCACTCGTCCCAGACGCAGAGTGGGGGCAGCGCCACCAAGAAGCGGAAGCTGGAGGCCGCCGAGAGCCGTAGCAGCTTCTCCCAGCACGCGCGCACCAGCGGGCGCGTGGCGGTGGAGGAGGTGGACGAGGACGGCAAGTTCGTGCGGCTGCGCAACAAATCCAGCGAGGACCAGACCATGGGCAACTGGCAGATCAAGCGCCAGAACGGAGATGACCCCTTGCTGACCTACCGCTTCCCACCGAAGTTCACCCTGAAGGCCGGGCAGGTGGTGACGATCTGGGCTGCAGGAGCTGGGGCCACCCACAGCCCCCCGACCGACCTGGTGTGGAAGGCACAGAACACCTGGGGCTGTGGCAACAGCCTGCGCACGGCCCTCATCAACTCCACCGGGGAGGAGGTGGCCATGCGCAAGCTGGTGCGCTCGGTGACTGTGGTCGAGGATGACGAAGACGAGGATGGAGATGACATGATCCATCACCACCACGGACCCCAGGTGTCTGGGCGCCCTACTCTGGGCTCCCACTCGACCCCGCCGAGTACAACCTGCGCTCCCGCACCGTGCTGTGCGGGACCTGCGGGCAGCCTGCCGAAAAGGCGTCCGCAAGCGGCGCGGGAGCCCAGGTGGGCGGATCCGTCTCCTCTGCCTCCTCCGCGTCCAGCGTCACGGTCACTCGCAGCTACCGCAGTGTGGGGGGCAGTGGGGGTGGCAGCTTCGGGGACAACCTGGTCACCCGCTCCTACCTCCTGGGCAACTCCAGACCCCGAACCCAGAGCCCCCAGAACTGCAGCATCATGTAGTCCGGGACCTGCCGGGCCGGGGTGGGCCGGAGGCCTCCTGCTTCCTCCGCGGTCATGCCCACCGCCTCCCTGCACCTCGCGGGAGGGGCTTCAAGCCAAAGAAAATACCCCTTTGTTTTTTCTTCTATGTTTTGTTTTTTTTTCTAAGAGAAGTTATTTTCTACAGTGGTTTTATACTGAAGG