Transcript asmbl_238122

Sequence
Transcript Sequence for observation asmbl_238122 of TGE0072881:
CGCAAGCTGCTGGAGGGCGAGGAGGAGAGGCTCCGCCTGTCCCCCAGCCCCACCTCGCAGCGCAGCCGAGGCCGTGCCTCCTCCCACTCGTCCCAGACGCAGAGTGGGGGCAGCGCCACCAAGAAGCGGAAGCTGGAGGCCGCCGAGAGCCGTAGCAGCTTCTCCCAGCACGCGCGCACCAGCGGGCGCGTGGCGGTGGAGGAGGTGGACGAGGACGGCAAGTTCGTGCGGCTGCGCAACAAATCCAGCGAGGACCAGACCATGGGCAACTGGCAGATCAAGCGCCAGAACGGAGATGACCCCTTGCTGACCTACCGCTTCCCACCGAAGTTCACCCTGAAGGCCGGGCAGGTGGTGACGATCTGGGCTGCAGGAGCTGGGGCCACCCACAGCCCCCCGACCGACCTGGTGTGGAAGGCACAGAACACCTGGGGCTGTGGCAACAGCCTGCGCACGGCCCTCATCAACTCCACCGGGGAGGAGGTGGCCATGCGCAAGCTGGTGCGCTCGGTGACTGTGGTCGAGGATGACGAAGACGAGGATGGAGATGACATGATCCATCACCACCACGGCTCCCACTCGACCCCGCCGAGTACAACCTGCGCTCCCGCACCGTGCTGTGCGGGACCTGCGGGCAGCCTGCCGAAAAGGCGTCCGCAAGCGGCGCGGGAGCCCAGGTGGGCGGATCCGTCTCCTCTGCCTCCTCCGCGTCCAGCGTCACGGTCACTCGCAGCTACCGCAGTGTGGGGGGCAGTGGGGGTGGCAGCTTCGGGGACAACCTGGTCACCCGCTCCTACCTCCTGGGCAACTCCAGACCCCGAACCCAGAGCCCCCAGAACTGCAGCATCATGTAGTCCGGGACCTGCCGGGCCGGGGTGGGCCGGAGGCCTCCTGCTTCCTCCGCGGTCATGCCCACCGCCTCCCTGCACCTCGCGGGAGGGGCTTCAAGCCAAAGAAAATACCCCTTTGTTTTTTCTTCTATGTTTTGTTTTTTTTTCTAAGAGAAGTTATTTTCTACAGTGGTTTTATACTGAAGG