Transcript asmbl_236865

Sequence
Transcript Sequence for observation asmbl_236865 of TGE0031172:
AGGCTCTTTTCAGAGCCACCCACACTCTCACTAACAGAGCTGAGAGCGGGCGTGTGCCTTTCTACAATCGGCGTTCGATAAGCATTAATGATGTCACTGAGGGAAACGTCACCAGGATCCCGAATGGTGGCCCCGCTCCCCGGGGTCCTAATAATCGTGCCCCCTTCCGGGTTCCCTGTGAGCGGACGTGACCTCAGAGCCGGGGCGGACGCCCCAAGCTCTCGGCGGCTCCTGGTCACCGTGTTAGAAATCTCATGGGCCGTGTGGGCCTGGGGGTCGCGTTTCATGAACTGTGCAGTGACCATCCAACGTCTGGTCACCATTTCATGTAAAGCATCCCCCCGGAGCGTCTGAGGCCACGGCCACATTTGAAAGTCCCGCTCGAGAAGCAAAGGCTCCTCTTGGTGGCGCGGCGCGTTTCCGCCACGTCGTGCGCGGGCCTGGGAGCTTTCAGGGCGCGTCCCCAGCCTTTCGCCCGGGCCGTGGAGTCCCGGCTGCGCGTCGCCAAGGCCGTTTGGCCAGCGCCTCCTGCGGGGCGGCGGCAGCGCTCCCCGTGGGGGTGGGGGGGTGACGGCTCTAACTGCTGCGTCTCCCGCCTGCTCCCTAAAGCCGCGCTCGGCGCTGAGGTCTCTAATGGCGCAGCACACAGTTCTCTCCCGGTCCTAACTCGTTTCACAGACAATGAATTCTCAGTGTTGAGTTTCGTCACCAGTGTGGCCACAGGATACGAGGATTGGCCGTGCAGCCTCCAGTTCGTCCTTCTCTGTCACTTTCTGCCCCTCCGAGTCGTCCCTCATCCTGGCTCCGGCCCCGCTCCCCTGCCGTTCAGTAGCTCGGGGCGGCCCTGGCCGGGAGAGCAGCGCGCAGGGCGGGAAGACACGCGGCCGCGGCGCCGGGACACTGAGGTCTGGAAACCTGCCCTTTGCCATCCCATAATGCTGAGAAGACGAAACCTCCAAAATGACAGAACTTTTCCTGCTCCCTGAATTCTCTGTAAAACCCGGGGCAGAGGCCCCGCCACGGAAGCTGGGTGACAACGGTGTGCTGAGTGGCACCTCACCCATAAATGGAAATACCAAGCGCACCCAAAGTTTCTTCCTGGTCCTCCCAGCAGGTCTATCTGGCCTCCCCTTTATCAGTGTTTACAGAGACACAAACGGCAAGCGTCGGTTTTCAGGTCACCAGGTCGCGGGCGCCTCTCGCCTTTTCTGATGCCTTTGGTTCCAGTCGGGGATGTAAGCGACAGTCCTCTGTCCATGGTGAACCCCATTCCTACTCCTGTCACCGAGACTTGGGGGGAAAGCCAACCAGTGCCCGTCAGTGAGCCCCAGACACAGGATCAGAAGTCGGGCTCTGGGCTCGAGCCCCACATGAGCCAAGCCGGGTGCGGCCCTCACCCGAAATGCTGATTCCACACCCACCGGCCACACGCACTCGGCTTGTTGATCAGAAACTCCCGTTCGGCTTCATCGTCGTGTTCTTGGGGATGCCATGCTCATCTCCACGCTGAAGGCTCTCCCAAAGACCGGGCTGTGCACCCACCCCCGAACTGATCAGTTTAAGGGACAAGACCCCGTGGGGCTGGCGGGGGTGAATCAGGACCCTGTCCAGGGAGCTAGACAAGACCTCCGCCTTTCCTGCTGCACGGGGCCGGGGGGAGAGGCAACCTGGATGAAAACGAGGCTGCGTTAGAGGGCGAGGAGGGTGAGGGCCCCCTGGGCGGGCGCCTGCACTGCCCGAGGCCCGGGCCTTCCCTGCAGACAAAAGGGGCGCCCACAAGGCTCATTCACACTCCAGCACCAAGCACTGAGCTACCAGCCGAGGACACGGAGCAGAGCCTCTCACACTGGACAGGCACTGGATTACCCGCAGGGTGGTCCCACTCCCACAGTTCCTATCTTCTTGGCTGTGGGGGGGATCTGGGGACCTGGCTTTCTAAAACGTTCTCAGAAGAGACAGATGCTGCGTACCTGCCACGTGTTGAGAATATCTCACCTCTGGTGAAAGACGAGCTAACCAGAGCCCCTGAAGGTGAGTGAGCCCTAAAACGTCTACGTCCCTGTGTGAAATATCCAGATTAAAACCACCTGACACACAAGGATGGTCCATCCACTCGTCTAATATGTCCCTCCCGTGCCCTGTCCAGCATGGAAGAGACCAAGGAAATGCTCACTGGGCATCAGCTTCCCTTGAGAGCTCCCAGGCCGATGGAAAGACAGTCCCTTACTTCTAAATACAGAGAAAACAAAACCGCATTTCCTGTGGTAAACCTAGGCTGCCGTTACAAAGAGACTCACCAATAAATTATTGTCACAGGGAAAGATCTGTGACTGGTCTGTGGGGCAGCTCTGCCCACTCTACTCAAGCAGAGACTCATCACTGCTGTCACCGCCTAGGGCCTGTTCTCTGCTCGGTTAACACCTTCCTCACTGGAGAGGAGTCAGGAGCACTTAAAGCTGCAGCTGGGGCAGACACTTACACTCGCCTCTGCCAGAGAAGCCAACACCACAGCAGCACTGCCAAGAGCCTCCAATGGTAAGCGATAGCGATCAACCTGCATTATGGATTAACTCTGACTGTAGAAACGTAAGAAAAAGCGTTATAAACTAACTTGACTGTTAGAATCAGTAATACCCCTACATCTGGATAAAATTAGTGACAAGCTCTTTCCAGTGAGTGGATAGGTGGCCCTGAAAAGGGCCTTTGGTTTTGTAGTAGAAAGCGAGCCGGGGTTCAGACTCAGCCCCCGAAGCCGTAGAGCGTGCGGCCCTGGCGCTTGAGCGCGTAGACCACGTCCATGGCCGTGACCGTCTTGCGCTTGGCGTGCTCCGTGTAGGTGACGGCGTCCCGGATCACGTTCTCCAGGAAGACCTTGAGCACCCCGCGGGTCTCCTCGTAGATGAGCCCGGAGATGCGCTTGACGCCGCCGCGCCGCGCCAGGCGCCGGATGGCGGGCTTGGTGATGCCCTGGATGTTGTCGCGCAGCACCTTGCGGTGGCGCTTGGCGCCCCCCTTGCCGAGCCCCTTCCCGCCTTTGCCGCGACCAGACATTGCGACTTATCAGCTGCTAAGCCTGTGACACAGTGACTATCACTAGCCCAGCTCACCATTTTTATAGTATCCTTACGGACCTGATTGTAAACAAGAAGAGCAGAGGCGGGAACCAACTCAGTTCCCGCCCTTCTCTTGTCGGTCCCTTGCTCAGAGCTCTGGAGACCCCGTGTTGCGTCTGAATCGACCGTGGATCCAGGGGGCGGGGTTTAAT