Transcript asmbl_232252

Sequence
Transcript Sequence for observation asmbl_232252 of TGE0007020:
CTCAGGTTTTTCACACGTGCTATTGCTTTGCTCATATAGAACCTGTACCAGTCTCAAGAGTTTTACATTCAAATTCGCCAAATGGCGGAAGTGGTCTTTTCGGTTGGATAGGTTTGCAGTCTTCCGCCTCAATGACCTTCCTAAACAGAATTCCTGAGATTAAAAAATAACCGAAATCGTATCGGTTCCCACTTCCTGGCGCTTCCTACCACGCCTCGGCAAATAATCAGAGACTAGTCTGAGAGGATAGAAATCCGGTTTAAGCCAGGGATTCCCGCGACTCACTTCCAACGCATACTCTATTTAAATTTTACACCAGGCAATTTAGGGGTCGGGGAAAAAGCTTTTGGGGGAGTGGGAGTCGAACTCATAGGCTCTTGCTCTCTCCATTTCCCGCCACACGCGGGCTCCCGGGTTAGAGAACAACGATCGCCGGCGAGGACGCGAGCAAAGTGCGCGCTCGGAGTAGGGGGAGGGGCCTGGCGCGCGCAGAAACAAGAACCGAGGTGGGTGGGGGCAGGCTCTCTCGCGAGAGTGGGTTTGTTCTTGGTCTGCAGCCGCTGCTGCCACCTCTTACCAGCGCCGTTGCTGCGGGGGATTGTGGGATCCTTCGCGTCCTGTTCGCTAGGAGAGAGGTACCTCTCCTTTTCCCTTTCCCTTTCCTTAAGAGTTGTCTGCTGGTTCTCAGCTTGAAGAAGATTCTACAGTCCTTATTGATCCTTTTTCTTGGCGTTACCATTTTTTTGAAGCAAAGTTGACCTAGTTTTGTAGTTTGAGCTTTCTTTTTGGCCATCTTTTAAGAAAATTTTTTTGGTAATCTATAAATTAGCCAAGAGATAGTTCTACAATGTCCAAGTCATTCCAGCAGTCATCTCTCGGTAGGGACTCGCAGGGTCATGGGCGTGACCTGTCTTATAGGCCTTCTTGCTGCTGCTACCCAGTCTTTAAGTATGCCAGCATCTCTTGGAAGGATGAACCAGGGTACTGCACGCCTTGCTAGTTTAATGAATCTTGGAATGAGTTCTTCATTGAATCAACAAGGAGCTCATAGTGCACTGTCTTCTGCTAGTACTTCTTCCCATAATTTGCAGTCTATATTTAACATTGGAAGTAGAGGTCCACTCCCTTTGTCTTCTCAACACCGTGGAGATGCAGACCAGGCCAGTAACATTTTGGCCAGCTTTGGTCTGTCTGCTAGAGACTTAGATGAACTGAGTCGTTATCCAGAGGACAAGATTACTCCTGAGAATTTGCCCCAAATCCTTCTACAGCTTAAAAGGAGGAGAACTGAAGAAGGCCCTACATTGAGTTATGGTAGAGATGGCAGATCTGCTACACGGGAGCCACCATACAGAGTACCTAGGGATGATTGGGAAGAAAAAAGGCACTTTAGAAGAGATAGTTTTGATGATCGTGGTCCTAGTCTCAACCCAGTGCTTGATTATGACCATGGAAGTCGTTCTCAAGAATCTGGTTATTATGACAGAATGGATTATGAAGATGACAGATTAAGAGATGGAGAAAGGTGTAGGGATGATTCTTTTTTTGGTGAGACCTCGCATAACTATCATAAATTTGACAGTGAGTATGAGAGAATGGGACGTGGTCCTGGCCCCTTACAAGAGAGATCTCTCTTTGAGAAAAAGAGGGGCGCTCCTCCAAGTAGCAATATTGAAGACTTCCATGGACTCTTACCGAAGGGTTATCCCCATCTGTGCTCTATATGTGATTTGCCAGTTCATTCTAATAAGGAGTGGAGTCAACATATCAATGGAGCAAGTCACAGTCGTCGATGCCAGCTTCTTCTTGAAATCTACCCAGAATGGAATCCTGACAATGATACAGGACACACAATGGGTGATCCGTTCATGTTGCAGCAGTCTACAAACCCAGCACCAGGAATTCTGGGACCTCCACCTCCCTCGTTTCATCTTGGGGGACCAGCAGTTGGACCAAGAGGAAATCTAGGTGCTGGAAATGGGAACCTGCAAGGACCAAGACACATGCAGAAAGGCAGAGTGGAAACTAGCCGAGTTGTTCACATCATGGATTTTCAGCGAGGGAAAAACTTAAGATATCAATTATTACAGCTGGTGGAACCATTTGGAGTAATTTCCAATCATCTGATTTTAAATAAAATCAATGAGGCATTTATTGAAATGGCAACCACAGAGGATGCTCAGGCTGCAGTGGATTACTATACAACCACACCAGCATTAGTATTTGGCAAGCCAGTGAGAGTTCATTTATCCCAGAAGTATAAAAGAATAAAGAAACCTGAAGGGAAGCCAGATCAGAAGTTTGATCAAAAGCAAGAGCTTGGACGAGTGATACATCTCAGCAATTTACCTCATTCTGGATATTCTGACAGTGCTGTCCTTAAGCTTGCTGAGCCTTATGGGAAAATAAAGAATTATATACTGATGAGGATGAAAAGTCAGGCATTTATAGAGATGGAGACCAGAGAAGATGCAATGGCAATGGTTGACCACTGTTTGAAAAAGGCCCTTTGGTTCCAGGGGAGATGTGTGAAAGTTGACCTGTCTGAAAAATATAAAAAATTGGTACTAAGGATTCCCAACAGAGGCATTGACTTACTGAAAAAAGATAAATCCCGAAAAAGATCTTATTCTCCAGATGGCAAAGAATCTCCTAGTGATAAGAAATCCAAAACTGATGGTTCTCAGAAGACTGAAAGTACAAATGAAGGTAAAGAACAAGAAGAGAAGTCAGGTGAAGATGGTGAAAAAGATACAAAGGATGACCAGACAGAACAAGAACCTAGCATGCTTCTTGAATCCGAAGATGAATTACTCGTAGATGAAGAAGAAGCAGCAGCACTGCTAGAAAGTGGCAGTTCAGTGGGAGATGAAACAGATCTTGCTAATTTAGGTGATGTGACTTCTGATGGGAAAAAGGAACCTTCAGACAAAGCTGTGAAAAAAGATGGAAGTGCTTCAGCAGCTGCAAAGAAAAAGCTTAAAAAGCGTCGTTTCCCAGGGAGTATGGAAGGTTTTGTCACTCTAGATGAGGTTGGTGATGAGGAAGATTCGGAACTTCAGAAACTTCGTAAATCGGGCATGGCATTTAAATCTGGTGACAAAAATGATGATGGTTTGGTTGAAATTAAGGTGGACAAGATCGAGGAACTTGATCAAGAAAATGAAGCAGCGTTGGAAAATGGAATTAAAAATGAGGAAAATACAGAACCAGGCGCTGAATCTGCTGAGAATGCTGATGATCCCAACAAAGATACAAGTGAAAATGCAGATGGCCAAAGTGACGAAAACAAGGAGGACTATACAATCCCAGATGAGTATAGAATTGGACCGTATCAGCCCAATGTTCCTGTTGGTGAGCTTTAAGGCTTTGTTCTTCCCCTCGCACCCTCCCCAAACTCTTATTAAATAAGATTTTTAAATTGGTCTTAACATGAGTTCTGATAGTGTTTCAAATTTATTTCTGTACAAAACAATTTGTAAATCTTGAGTGATGCATTCTCTTTTCTTATCTAAGTCTCCTGATTTTGTATTATCTTTTATCATTACACAATATGTTCTCTTTTTCCCTCATAAAGGTTTCTGAGAATTTCACATTGCCTTTTATTTTGTTTACCTGTTATATTTCTGCCTTTTTAAGACTATAAAATAGGTGGAACCTTACACAACAATTAAACACAATTCTGTTAACTAATGCTGTTTTTTTGTTTGATTTTGTTTTACCTTAGGCTATACTGGACTTCTCATAAATGTTATCTCATTCAGATTATACTGACAGGAAAAAAAGATTTGAGAACACTAATTAAAATACTCAGTTTACTGAATTTGTAAGAATGTATGTTTGTGTTCTAGGTATAGACTATGTGATACCTAA