Transcript asmbl_11981

Sequence
Transcript Sequence for observation asmbl_11981 of TGE0000111:
GAGGCCTGGGCTCGCCTGGACCACAAGTTTGACCTGATGTATGCCAAGCGTGCCTTTGTTCACTGGTACGTGGGTGAGGGGATGGAGGAAGGCGAGTTTTCAGAGGCCCGTGAGGACATGGCTGCCCTTGAGAAGGATTATGAGGAGGTTGGAGCAGATAGTGCTGACGGAGAGGATGAGGGTGAAGAGTATTAACCTGTGTGCTGTACTTTTACACTCCTTTGTCTTGGAACTGTCTTATTTTTGTTCTGTAAATGTCTATTGCCGTAAATTGTTAATAAAATTGAAGTTTCCATTTT