Transcript asmbl_231739

Sequence
Transcript Sequence for observation asmbl_231739 of TGE0002143:
CCGACTTCCAGTCAGCCCCTGGCGGAGGAAGTGATGTCACAGGCCCCATGTGAGCGGATTGCAACACATGCAGCTGCCTGGAGAGAGGGAACCGGTGTCCTACGTCAGAGCCGCCGCCGCGGAGCCGCCGCCGGGGAGGAGCAGCCACTGCCGCCCAGGACTGGGCCCTTAGGGAGGAGGAGGCGAGAAGATGGCGGACGACCCCAGTGCTGCCGATAGGAACGTGGAGATCTGGAAGATCAAGAAGCTCATTAAGAGCTTGGAGGCGGCCCGCGGCAATGGCACAAGCATGATATCATTGATCATTCCTCCCAAAGACCAGATTTCACGAGTGGCAAAAATGTTAGCAGATGAGTTTGGAACTGCATCTAACATTAAGTCACGAGTAAACCGCCTTTCAGTCCTGGGAGCCATTACATCTGTACAACAAAGACTCAAACTTTATAACAAAGTACCTCCAAACGGCCTGGTTGTTTACTGTGGTACAATTGTAACGGAAGAAGGAAAGGAAAAGAAAGTCAACATTGACTTTGAACCTTTCAAACCAATTAATACGTCATTGTATTTGTGTGACAACAAATTCCATACAGAGGCTCTTACAGCACTACTTTCGGATGATAGCAAGTTTGGCTTCATTGTAATAGATGGTAGTGGTGCACTTTTTGGCACACTCCAAGGAAACACAAGAGAAGTCCTGCACAAATTCACTGTGGATCTCCCAAAGAAACATGGTAGGGGAGGTCAGTCAGCCTTGCGTTTTGCCCGTTTAAGAATGGAAAAGCGACATAACTATGTTCGGAAAGTAGCTGAGACTGCTGTGCAGCTGTTTATTTCTGGGGACAAAGTGAATGTGGCTGGTCTCGTTTTAGCTGGATCAGCTGACTTTAAAACTGAACTAAGTCAATCTGATATGTTTGATCAGAGGTTGCAATCAAAAGTTTTAAAATTAGTTGATATATCTTATGGTGGTGAAAATGGATTCAACCAGGCTATTGAGTTATCTACTGAAGTCCTCTCCAACGTGAAATTCATTCAAGAGAAGAAATTAATAGGACGATACTTTGATGAAATCAGCCAGGACACGGGCAAGTACTGTTTTGGAGTTGAAGATACACTAAAGGCTTTAGAAATGGGAGCTGTAGAGATTCTAATAGTCTATGAAAATCTGGATATAATGAGATATGTTCTTCATTGCCAAGGCACAGAAGAGGAGAAAATTCTCTATCTAACTCCAGAACAAGAGAAGGATAAATCTCATTTCACAGACAAAGAGACAGGACAAGAACATGAACTAATTGAGAGCATGCCCCTGCTGGAATGGTTTGCTAACAACTATAAAAAATTTGGAGCTACATTGGAAATTGTCACAGATAAGTCACAAGAAGGATCCCAGTTTGTGAAAGGATTTGGTGGAATTGGAGGTATCTTGCGGTACCGAGTAGATTTCCAGGGAATGGAATACCAAGGAGGAGACGATGAATTTTTTGACCTTGATGACTACTAGGTAGTCGACATGGGTCCGGCAAAATGTGCCTCACCCTCCAGCATCCAACCCAAGGAGCATACCCGTGGTGGAATCCAAACAGATCCCTGCCTTACAATTGGAACATTTCCAGAACTTAATCCATGAGCATTGGATATTGAAAAGAAAACCGAAACAAAACCAGACCCAACCCTACACTTTGGTTTGTCATGGTGTCAGCGCAGCAGCCTACAACTAAGTTCCTAAATGCCACTTTGGACTAATTTAAACAAGAATCCCAGTTTTTACTTTTACTCGATGGTGAAATTGGTTGCTCTTGTATTTTATGAAAAAAAAATGATTTTTTTAACCTTCATACATAGAAGCAAAAATACTTTAACTGCTGTAAACCTTCAAAAGTTAATAGAAATGAGATCATACTGGTTTGTTTCTTATTTTGATTGGAGAAAAATTAAATTGCTGCATTTCGCAGTGACCCATTTACATGGCATTCTCAGCTTAGACTGCATAAGAAGAAATATACGTGGTGAAATGTTGGAACCATTTCTCTCTTGGTCTCTTGTTTAATGTTGAAAGGGTGAGCTAATAGGCAATTTCAACTTCACTCCCTCACACTACCCGTGCCCCTACAGACTGTCAGTTTCAAGGATGCAAATTGCATTGCAGCGTCAAACTGACAACATGAAGCATTTGGGCCAGTGCACCGTTTCCTTCCACGTGTTTTGCAGGCGCATTTGTGCCCAGGGTTTGGGAGCCCTTAGCATCAATTGCTTTGACAAGGGTTCTCATAATCTTAGCCTACTAGAAACCAGTTTGGGATGGATATGGGGCTTCTGTGCTATTGCTGGGATTGGGAGAAATAAAACATGCAATATAAATGGAAGCAAAGAAATTTAAAGAATATTTTATTTTGCTTGGGTCTATCCTTGGTCAAAGGGAGGTGGTCGTGTTTTCCTTGTGTTGGATGGCATGAGATTATGTGAATGTTTTGATTTTTTAAAAAAAATGAACTGCAAGGTTTTTCACAGGAACGACAGACAAGACACGTATGACTGTGCATGTAATTATAAGCCCCTGACCTCCTGGTGGGGTTGGAGCATCTGTTTCGAATATGGGACTTGTAAACACCTCTCATAGGAGAAAGTATGGGAGGCGGGTGGGAAGGGCAGGGGTGGGAAGGGATGGGACACAGCTTCTGGCACCAAGGACTTAACCATGTTGGATCCAAAAGTGGGCCTGAAAACCTGAAGCTCATGCTTCACAGCTGAGCTGTGAGTCAGACTTGACCCCAACTAACATGCAAAGTCATGGCGTGCCCGAGGTGGTGACAGTGAACAAAGTGTGTAGGATGTGCCCAGTGGTAGCAATGGAAAAAACGTATACCAAATGGACTTTGAAGGACCAAAGGTTTTAAAAGTCAATTGGTATCACCCCCACACTGATAGGGTAGTGGGGTGCATTTGATTTTCAAATTGGGTACTTCAACACTTTAGTGCCTGACTGCTGTTCTTCACTGACTTGACTCAGTCACTCGTAGCTTTATTGGTCTGAACCAGCTCCTTGTTCCCAGGTTGCAGACCTGCCTATCGTTCCAATAATCCTGTTTCACTTGAATGAAGGGAGTATGTCTTAAATGTAAAGTTTCTGGTTCTCACACTGTATTCTGAGGTCCAAATGACTGTCTGTGGATGTGTAACCTGATGTCTCAACCCCCAATGAGAAGAGTCAGTTCTTTGGTATTCACCAGCGCGGGAGGCTTCACTGGAACAGGCTTTTGCTTTGGGCTCTGCTGTTTGTTTGCAGAACACCCAAGAGCGAGCAAACATGCTCTCTTCGCAGCAGTACCTTAGGGTTTTGCCATTGTAAATGGGTCTAATGTGATATGACAAGACCAGAGAAATTGGATGTAAATTTACATTTTTGAATATGTTTGTTTCACATGATACATTTAGGGTATGCAGCTCCTTTTGTAGTTTTTATTTTTACTATTTAAGTTTGGAAATGATGCCAAATTTTTGTATTTCTTTAATCAATGTGTTCTCTTCGGTGATATATATTGCATTATATATTGATGTGTGTATCAATATATACTGATATGTATTACACTTACACATACAAACACATAAATAAGAGGGGGTGAAAACCGTAGCCTTTGCATTCTCTATAGCCTCTACAGAGAGATCCTAAGCAGCGAAATCTTGGTGTTGTGATATACAGAAATGGAGAAGAGTATTAAACCATATTTAAGAATATACTTTGTGTGCTTGAGATTCTTTAGGAATGCTCCTAGAAAGGTCTGAATGTGGAGACTGAGTGAGCTCTCCAAGGCATGTGTCAGTTTAGTAGTGGGTAAAAACTTTTCAGCCTTAGATTTTAGTTGTCTTCACCACATTTGCCTGTGGAAGGGTACATGCAAAGGATGTCTGAGGTCATGATCCCAAAGTTAACACCAAAGGGAGGAGGTTCAAGTTGTTGGACCCAAACTAATTTGTATCTTCCCCCAATCCCACATCCACGCTAAGGGGAAACCTGCCCCCTTTTTTAGGCATTTTAAGTATGTTATCTCATGTAACCCAACATTGCATGGAGGTAGAGGGCATATCCCTTTTTACAGGTGATGAAATAGGCCAAAAGAGATTAAGTGGTAGCCCTTTAGTGGCAAAGCCAAATTTTAGCCCTGGCCTAATTTTAATTTCGAAATTGATTCTATATCTGGTTGCCTTTAAGTCAATAGAGTGGGCTCAGTGGAAAAGCAGACACTAACCCTCCCACTCTCCTTTTTCTTACATTCCTGGCACTGGGTAGGAGAGGAAATAACCATCCAAGAGCAAGTCGGAGGCTGGCCCAGTTGGAGCACTGCTTTTAGGCCAGGTCAAGAACAGAAGAGAATTTAACATTTCTCCAAAGGTTGAGGTGCTTGAGCTCCTATGTGGCAGCTTAGGAAGCCTAGTTGAAGAACCAGGATGGTGCACGTTTTGCTTTCTCCAGATTTAAGAAAACAATGTTTTTAATAAAATTGACCCATAATGGCACTTTTTCTGTCACTGCTTTTTCAGCATATATTTGCCCATTTTCTCATCTGGTCTAGTTGATAGCCTTGAAACCCAGTCACCCTTTGGGAGGGACAGACCTGCCTGTACATGCCTTTTCTCCTAATGCATCCGTAGGTGCTGTTTGAAGTCAAAAGTTGGAAAGTAGCACAGTGGTGCCGGATATGTGGGCTGTTGTGCTTGCCTGTCTGGACCTGCAGCACTTGCCATCTTTTCTTCTCTGGCTCCAGTTCTCATACCATGACGCTCCCAGACAGGCACAGTGGATTCAGGGCTGAACGCCAAGGTGAAATTTTAAGTCTTGTGCCAGCTTCTCCCTTGTTGCCAATTTGAGTGAATGCCTGCTGGGACTCATACCTGCCAAGTCCCACCCTGATGGGACACTGCCTCCAGGGACATAGAAACTGACCAGCCAAGGAATGTGAAAACATTAGGTGCCAAAGTTACTGAGGACATGGCTGAACCAATAGGAACTAGAGGTACATGTGAAAACAATTTACCTCCAGGGTTCTCTGATAATCAACTCTAAACCCTGTCCGGGAACTCGGGTATAGTCTGAAATTGCTTGGCAGGATCATCCTGAGGCTAAGAGCCCAGGGCAGAGTCAGCTCTGTAGACAAACAGCTCTGCTGCTAGCTCTGCCATTAGCTGGTCTTGTGATTTCAGGTAAGTCTCTATCGGTTTCTTTATTAGTGTAAGGAAGGCTGTGAATGTGAAGAGACTTGCCAGGTGTAAAACTGTCAAGGTAGCATCATGGTGGTGAGTGAGACATCTGACATCTGACTGGCTCTGCCAGTGAGATGTGGCAAATTATTTAATGTCTCAGAGCAGCGATTTTTCTACCTGTAATAATGCTCCGTTATGATTATGGGAAGGGTTAAATGCAATAAGGCACCTGAAATGCATAGTATGCCTGACACTTAGCAAGGCCTCCAAGATGAGAACTGCTCCGACGATGTTCCACCACTGTCAACCTTGTTTCTCCAGAAGTGGCCAGGGTTACTTTGTGCTGGTGAACCACCAGGTGGTGCTAGAGTTAAAGATGCTGTGGAAGAAATTTGTTGTTTCTGATGGGGAGAGTTCTGACAAGCATTTATATGTGTCTGGTACAGCTTGCTTACCCTTAAAGTTTGGAGAAATGGAGAGGGCAAACTACCAAAGGAAGTAAGAATGAGTGAACAGAAAGGAAATCCCAGGGATCTTGTTCTGGGTTTTGAGCTACCCAGCTGTAAAATAACTACAATCACTAATACTTGTTGAACAGTTACCATGCACCAGGCAGGGTGTTATATCATGTGTATCATTTCATTTAATCCTTATAAAAACAATGAGGTAGGTACTGTTTTATATCTGCCTCTCTAAGTTCACAAACCACTAAGTGGAAAAATATGGGACTCAAAGCAAGTCTGTTTGGTTTCAAAGCTGATGTAAATGCTATTCCTTGCTCAAGAAGGGAGACAGCAGTTGCTGGTACTGCTGAGAAGACAGGTGGACTCACCTCACCAACCCTTGTGCTTTCAGAAGCAACCAATGGCTCAGATTGCATCTGGAAAGCACCCATCTATCAGTTTTGACCTTCCCCAACACACACGCTTTGACTGGTCAGCCGAGCTTATCCACAGCCACAGTCGAAGATGGAGAAAAGGAGCTCCCTTGGACTCTGTAGAGGACCCCTACAACTTATCCAGCATCTTCAGAGAAAGATGTACGCACGTAATGGAATTTCTCAGAGACTAGTATGTCTGCTTCTGCTCTTAAATATGTCGTCAGTAGGACAATTAATGAAACTGAAATGTGGACTATAGATAAAAGTATTGCAACAATGTTAAATCTGAATTTGATAATATTACTGTGGTTATGTAAGAGAATACTCTTTGTCTTAGGAAATATACATTGATGTATCAAGAGGTTTAAAATAAGGCATTTATTAAGGCAATTTTTGAATTTTAGAAATGCAGAAAACATAAGAGAATCATTTAATTATATTTAATAGTTTAGGGTTATGAACATCCATTTTAGAAGTGTGATCATGAGTGTTTAGGTTTAAATTGGTTCACAAGGTATTTAAAACAACTTTGGTTTGATTCTTTATTCAAGTTTGGTTTTTACTCAGAATTTGGGTTTGACTCAGAGGTCAGCATTTAGAAGAATTAGTTCTGCTACAGGGTTTGCAGTTCGTGAGAAATCCCTATTCTGAATCAGCCAGTGGAGTTGCAGGGCTGAGCCTGGGAGTTAGGCTGAGCCTGGAAGGAAGAGGAACAGAGGCATGGCAGGGAGAGGAGCTGCTATCACATGCCTCAGAGATGAAATCGCTTTGGGGTTGGACTGGTGCTGGGTAAAATGAGGCAGTATCAAGAGCAAGGGCTTTGGCAGAGGGCCCTTCACCCATAGCTCAGAGAGCAACCTGGGGATGATGGAAAGAAGGCAAAGCTGTATCTGGAAGCCTAGGGCCCACTCTCAGGACAAGAGAGTCATTAGACAGTCCTTTGTCTACAGCCACACCCTTATATATCTCTGTTGCTCCATACTTCTTAAAGAATCATCATTTTAGCACCTGAAGGGGACCTTACATTCCGATCCCCTCATTAAAGAGATAAAGCTGAAGCCCAGAGAGCAACATAATGACCTGTCATGCTTGAGCAGCAAATTAGCAGAGTCAACATGAGCATCTGATGTTACAACTCCAAATTCAATGCTCTTAACACATGGATGATCTTCATTATTCTTCATCTAAGCCTTTTTCTCCCCCTATTAGGGATCAGAAAAGGGAGGATCAGAGAGAGTGAGTGAGTGGCCTGAAGCCAAAGACAAAACTGGGAGGGGAAAGGTGGCCAATGTCCAGGTGGGATTACGAAAGCTGTTTTGAAGTCACTTCCCTGAGTCAGGGTTGGCTTGAGTGTGTAGATTAACTTGCTTCTCCAGCCCCCAGGGTTCCAAATTAGCCTCATCTAGGTTTTCTTGACTGTCAGACTTCTGGCTCTCCCATTCTGCTGAGGCCCCTCTGTTCTCCATTTTCAACCAAATGAAACCTAGAAGGTAAACCCATTTCTAGGGAAGCCTGAAGACCAGGAAAAGAGGATGAAAACTTCAGAGGCACTGACACTCGTACAGTTGAAAATCTGTGTATAACTACAGTCTGCCCTCTGCATCAGCAGATCAAAAATAGTTTACCCTCAAACAACGCAGGTTTGAACTGCGCTGATCCATGTATACACGGGTTTAAACTCGTGACATCCAAGGGCCAACTGTATATGATCTTTGTACCCAGTTCCTGACACACAGCTCCTAAAACCCTCAGAATCTCCAGAGTGATAAATCTTTTGTATGCTAATGAGATGACGGGCGGCTGGGGGCCCCTAGATAGCTTTAGGGTGGGGGCTGGTTGCCAGAAAGTCAGGATTATAATTGGAACTTCCATCCCTACCCCCACCCTCCAGAGGCTGAAGATTAAGTTAATCACCAAGGACCAGTTATTTAATCAATTCCATTAAAAACCCCTAAATGGGGTACAGAGAGCTTCCAGGTTGGTTGGTTAACACACTGAGGTACTAGGAGGGCTCCTTAGAACTCCATATGAATTTGAGAATCAACTTTTCCATTTCTGCAAAAAAGGCCATTGGAATTTTGATAAAGATTGTATTGAATCTAGACTGCTTGGGTAGTATTGCCATCTTAACAATATTAAGTCTTCCAATTCAT