Transcript asmbl_231624

Sequence
Transcript Sequence for observation asmbl_231624 of TGE0006979:
TACTATTGTCTCTGGCAGCCACCGCGGGAGCCCAGGAGGGGGGCGGAGGCGAGGGGAGGCGGCGGCCGCGGCCAGCGCACCATTCGCTCCACCTGATCTCGGGGCGCTGTGCGCTGAGGAAGTCGCGGGCGAGCGGGAGCAGAAGGAGGGAGGGACGCCGCCGCTGCAGCCACCGCCGCCACCATGTCCTACCAAGGCAAGAAGAACATCCCGCGGATCACGAGTGACCGTCTTCTTATCAAGGGAGGCAGAATCGTCAACGATGATCAATCTTTTTATGCTGATATTTACATGGAAGATGGCTTAATAAAGCAAATCGGAGACAACCTGATTGTCCCTGGAGGAGTGAAGACCATCGAGGCCAATGGGAAGATGGTGATTCCTGGCGGCATCGATGTCCACACTCACTTCCAGATGCCCTACAAGGGGATGACCACAGTGGATGACTTCTTCCAAGGGACAAAGGCCGCCTTAGCGGGTGGCACAACCATGATCATTGACCATGTGGTGCCCGAGCCGGAGTCCAGCCTGACGGAGGCCTATGAGAAGTGGCGAGAATGGGCCGATGGGAAGAGCTGCTGTGACTACGCCTTGCACGTGGACATCACCCACTGGAATGACAGTGTCAAGCAGGAGGTGCAGAGCCTCATCAAGGACAAAGGGGTTAACTCCTTCATGGTTTACATGGCCTATAAGGATTTGTATCAAGTGTCCAACACAGAGCTCTACGAGATCTTCACCTGTCTGGGAGAGCTGGGAGCCATTGCTCAAGTTCATGCTGAGAATGGGGACATCATCGCCCAGGAGCAAAGCCGGATGTTGGAAATAGGGATAACTGGCCCAGAAGGCCATGTACTGAGCAGACCAGAGGAGCTGGAAGCTGAGGCCGTGTTCCGTGCCATCACCATCGCCAGCCAAACCAACTGCCCTCTCTATGTCACGAAGGTCATGAGCAAGAGTGCAGCTGACCTCATCTCACAAGCCAGGAAAAAAGGAAACGTGGTCTTTGGCGAGCCCATCACTGCCAGCCTCGGCACAGATGGAACCCATTACTGGAGCAAGAACTGGGCCAAAGCAGCTGCCTTTGTGACATCCCCACCTCTGAGTCCTGACCCGACCACTCCTGACTACATCAACTCCTTGCTGGCCAGTGGGGACCTGCAGCTTTCTGGCAGTGCCCACTGCACCTTCAGCACCGCCCAGAAAGCAATCGGGAAGGACAATTTCACAGCCATTCCCGAGGGCACCAACGGGGTAGAGGAGCGGATGTCTGTCATTTGGGACAAGGCTGTGGCCACCGGGAAAATGGATGAAAACCAGTTCGTGGCCGTGACTAGCACGAATGCTGCCAAGATCTTCAACCTGTATCCCCGCAAGGGAAGAATATCTGTGGGTTCTGACAGTGACCTGGTGATCTGGGATCCAGATGCAGTAAAGATTGTGTCCGCCAAGAACCACCAGTCGGCTGCAGAGTACAACATCTTTGAAGGGATGGAGCTGCGTGGAGCCCCTCTGGTGGTCATCTGTCAGGGCAAGATCATGCTGGAAGATGGCGGCCTGCACGTGACCCAGGGGGCTGGCCGCTTCATCCCCTGCAGCCCCTTCTCCGACTATGTCTACAAGCGCATAAAAGCCAGGAGGAAGATGGCAGACCTGCACGCGGTCCCGAGGGGCATGTACGATGGGCCCGTGTTCGACCTGACCACCACGCCCAAGGCGGGCACCCCGGCGGGCTCCACGCGGGGCTCTCCCACGCGGCCGAACCCGCCCGTGAGGAACCTCCACCAGTCCGGATTCAGCCTGTCGGGAACCCAAGTGGACGAAGGGGTCCGCTCCGCCAGCAAGCGCATCGTGGCGCCCCCTGGAGGCCGTTCTAACATCACATCTCTGAGTTAAGCCACCCCTTCCCAAAGAGGGGCAGAAGCAGCAAGAGATTTTTTGAAGCCAAAATGGTACACCGATATTTAAGAAGGAAAGCGAAAACAGTTGCGATCTAAAGAATCAATAAGCCTCAAGCCTTATGTTTCTCCAATGTTACGCTCGCTTGCCTAGCTTTACGAAAATTGCTTTGTTTTCTGTCTGTGCCTAGCCTTGATTTGGTTGACTCCTCCCCCCCATTTGCATGCATGCAATCAGGCCACTAAGGTAAAAGAGTCTGCTATATAGTGTTGAGAGCGTGTGTAGTGCTGCATCTTAAGACAAGGGGACAGACAAAGCTGGATGTCAGGAAAATGAACAAAAGGGACACAGTTATTTGGGGTGAGTGGGTGGTGGGAGCCCAGAGCAAGATGGAGGGTTCAGCGGGGCTGGGGTAGGGTATGTAAGCGGGGCAGGGGGTGGGTGGGTGAGCTTAAGGGGGTCTTGTGTATTGTGTTAATGAAGTACATTTATTTCCATGGAAGATGGCCCCTTGGGGCAGCTGTCACTTCATCACAGTCCCCTGGGGTCTGCAGAGAAGGCAGGTGGTCTTTAGGTTCCGGACTTTGTCACGTCCTCTCTTCATAGATTTTATTCTTTTGAACGTTTTATTAAAACACCAAAACCCAATCATTGCTTCCACCCACTTGGTCGTGCCAGTGTTTGGTCGGGCCTCTTTCTCAGTGGTGCTTTCAAATTCTTCTCTTTCTCGAGCTGGGAAGGAAGAGAGGAGAGAGGAAAGACCCTTCTCTTGCCTTCCCGTCTCTTTGGTGCTCTTAAAAAGGCAACAGCTGGGAGCACAGCACAGGCCCTCAGGGTGGGGCAGGGCAGCCGCACTTAAATAACACCTCCCTCCGAACACGTGTTGGAGATCACCTTTCATTCATCTGTCTTTGCAAAGCCGGAAGAACAGCGTGCTTCTGGCATCCCGGAGTTAGGAGTGGAGCTGGGATGGGGCCGGTGGTGAGAGAGTGACTCTGGATCTCCTGAGATCCGGGTGCAGCCATGACGGGATTTTTGTTGTTGTCAGAATTTTCTTTTCTTACGTGTTCCTTAACTTTTAGTGCAAATAGGTCATCTCAGCTTATAGGGGAGTCAGGCAGGGGTTTGGGAAAGCTTGTCTGGAGCAGAGGCAGCACGTTCTGTGGCCAAGGTTCTAGTTTTCAGTCCTGAGCCATCTGTTTCTCCTTCTGCTAGCACAGCCTTTGGGGGAACGTTCGTTTTGGTACCAAAGTCTCCCAAAGCGGTGGCAGTCACATGCAGCCTTTGAGACATGGCACAGAAAGGTAGTTAGCGAAGAGCATTTGCCTCTGCCTTGTCTGTCAGAGCTGAATGTCCATGTCCTTATTCTGCCGCTTCTGAAAAATTCAATTTTAGAGCAAGTTCTTTGAGCCAGATCAGATCTATAGAACTAAGAGGCCCATACGCAGGAAAATTCAATTCAACCTGGGATCAAACTTCCGTGTTGGGTGATCCAGCTGGCGGAATCCACACCCCTGTGTACTAAGTACTTTGAAGAGAAGAACAGGTGTTTCTCCCCCAAACACCATTCAGGTTTTCAGGAGAAACCGGTATCTTTTACTGAAGGTTTTATGTTGAGGGCCAGAGAAAAGGGAATACGTGGCCAATGAGGCATTTGAAAATAGCCAAGGAATAGGATCTCCCTTAGCAAGCTAATTTTTGTTTTAATCATGAAAGAGATTATTTCCTATCAAAAGAAGGAATCTTGCTACTTTTAGGGCTTTTTCATGGTGCCTTTATTCTAAAGAAACTTAAACGAAGGGTGACTGTACTTCTTGGTTTATAACTCACAGATGTGGGGGCCTATTGCAGTCTGGGAGTGACAGTTTTGCAGACGGAGCTTGTCATTTGGGAAGCATATTCTATATACCTCAGTGGCTGGGCTATGCGTTAGAATATGTTGCAGTACCAGCCATAACCACCAGATGGAGGAAAAGACACGTAAATAGTCGGAGTGCCCACTGATGTACCACTGGCAACTGTTACCAGCCGCTGCGTCCAACCCATCCCTTCATGACTTTTCCTGTGCCATGGCCCAGTTGGTTGCATTTGGGACTTCTGAATGAAACATTCATCCAGAACGTTATATTCTACCGACACGTTCCATGCTGTAGAAAACAGCTTCCTAAGGCCTTGGTGATAGGCAGCAGCATGACCTGACAGGGCCTCCCTTTCTTTACTTACTATTAGTAACTTTCCAAGCATAGAAATTCCTGAGAATTCCAAGAACACTCCCACTATTTTCTTGACTTCGATTTCTGGTTTCTTGCTCCTTAAGTTAAAATTTCTATTCAAATTTGTCCTGTTCCATAAGACACATCGAAGAGCCCCACGCAGGGTTCCGGAAGAGAACCTAACAGCAAATCTTGGGCGTCTCAGAATTCACTGGCACCTCATCCAGCTATGGGAGGGTGCGCTGGGTCTTCTGTCTTCCTCCTAAGCTCCCTTTTGCTGTCTCATGTCTCGGCCCCTCTCTAAGGATGCCACACCTTGCCAAGCTTCTCACGTTGTTTCTAAACCCACATGGCAATCAACGAGGGTGCTGTCTGGGAAGGCCACAGTCTTGGGTAGTTGGGTAGTTGAGAAGGGATCTGGAACTGTTAAATCAGCCACCCCAATGGAGATATTTCTTCTAAATTTTCTAAAAACGGAAATGTCAGAATCATCCCAAAAATACATTTTCTTCAGAGTCCAGTCATCCGTTGAGCTTTTTCCTTGTGACTACACCCAGAGAGTCACGCTCTGTCCCAAGGGCCTCAATCCTAAGTCTGGACTTTCCGCTCACCCTGAGAAGCCCTTCCCAATAGGGTGACGAGAGTCCCACAAGCTTTCCAGGCCTTCTCCCCTGGAAAGCTCCAGCTCGAGCCCCAGAGGGACACATGGGCCGTCCAGGCAGCCAGCATTCGGTGTAAGTTCCCTCTTTGGAAAATGGCGTGTGTGTGTTCAGTTCTGTGTCTGGTGACTATGAACAGACAGTAAATGTCCCTGTGATCTGTGGTAGCTGTGGGGCAGCTCTGGAATGTGAAGAGCTGTTTGGTTTGAACCGTGAAGAAAACTGTGTTTTGAGTTTAGCTAAGATT