Transcript asmbl_231316

Sequence
Transcript Sequence for observation asmbl_231316 of TGE0006960:
AATGACCACACCCCTGGGCACAGGGGAGATGAATGACCTCACTACTGTTTTCTTGCCTAGGCTTGAAGTAGGTGCGGGTGCTGTCCCTGCCTGCAAGCCCCAGTCCAGTCACACCCTAGTTATTTGCGGGGAGGGATTTTCCTGTGCCTCCGTTTACCTAACCACCCTTTTCAAACCAAGCAGCTTCTAACCACGTAAGCTAACCTGGAGTCTTGAGCTAACCTAGGCAAAAAGTTTCCCACTGGAGCACAAGTCTATGGGTTCTGGGGTGGAGTAGAGGTCGTCCCGGGAGGAGACCACCGCCACTCCCCGGTGGAATTCCCAGCTCCCCAGATCCTTTAACCCAGTCTCTCGTCCACGCCCCTCTCTTCTAAGCATGGCCCTCGGCTTGCGCTACGGCGCCTTTAAACCTTGGCGGCTCTCGCCCCGCCCTCGGTCCACCCCGTCCGAGGCGGGAGCGGCTGAAAACCTCCAGCCCGGCCCGAGCGCACCACTTGCCTTGCAGCCCCGCCAGGAGTTCGCGCTCTCTGCACTACCCTACGTTCCCCACAGCCACCACCACCCTTCAGAATGGCCAACAGGGGACCTGCTTATGGTCTGAGTCGGGAGGTGCAGCAGAAGATTGAGAAGCAGTATGATGCAGACCTGGAGCAGATCCTGATCCAGTGGATTACAGCCCAGTGCCGCAAGGATGTGGGCCGGCCCCAGCCTGGGCGTGAGAACTTCCAGAACTGGCTCAAGGATGGCACGGTGCTGTGTGAGCTCATTAATGGACTATACCCTGAGGGGCAGGCCCCAGTGAAGAAGATCCAGGCCTCCACCATGGCCTTCAAGCAGATGGAGCAGATCTCTCAGTTCCTGCAAGCAGCTGAGCGCTATGGCATCAACACCACAGACATCTTCCAGACTGTGGACCTGTGGGAAGGAAAGAACATGGCCTGTGTGCAGCGGACACTGATGAACCTGGGTGGGCTGGCAGTGGCCCGGGACGATGGGCTTTTCTCTGGGGATCCCAACTGGTTTCCTAAGAAGTCCAAGGAGAACCCTCGGAACTTCTCGGACAACCAGCTGCAAGAGGGCAAGAACGTGATTGGGCTGCAGATGGGCACCAATCGTGGGGCATCTCAGGCAGGCATGACCGGCTATGGGATGCCACGCCAGATCCTCTGATCCATCTCCAGCTCTTGCATCTACTCTCCCGTGGATGGTTAATATATATAGATAGATAGATAGATATGCATATCCATCTACATATATATATTAGCAGTGACATTCCCCAAGAGCTCCCTGAGCTTTCAACCTCCCCACTGCTAGGGTGAGGGCCTGGCCTGGCCTATCTCCTCTGGGGGTGCCCAATGGTAGCCTCTCCCCATGTGCTTACTAATACATTCCCTTCTCCAAACCCACAAAAACTGGACCAACTGGCCTCTTTTCTCCTGGGACCAAAATTTAGGGCTTCTTCCTTCCCCCACCCCATACCTCTTCTTCTCTGATCTCTGTGCCCTCAATCCATTCCTTGGCTGGGGGTTGGCAATGCTACCTTTGGACCTTCCTTCCACAAACATGCCTCACCCACAGCTGTGGCTACAGGGACTTAATTTATAAGGAGGGGCCAGTAGCGGCTGCCGCCCCTGCCGCAGCTGGACTGGGTTCACCACACATTGGAGGCAGCCTGCCCGGGCAGAGGCCCTCTTGGCTTCTCATTTTCCATTCCCCTCTCTGTGGCTAAGGGGTGCGGTGAGGGGACAGGGGATGGCGGGGAGCTGCCCACTCTGGGCTGGGGCTCGAAGAATCTGAGTTTACTGATTTCAATAAAGAATCTTTGTTTTTTTTGATGGA