Transcript asmbl_23092

Sequence
Transcript Sequence for observation asmbl_23092 of TGE0007464:
CTTCCGGCCTGTCTTAATTCCGCTTCCGGTCAAGCGGAATCGTCTTTGCTGAGGGTCACATTGAGCTGCGAGCTGTTTCAGGGGCGTCTTTAGAATGCCTGCCAGCACTCTTTGCCTCCAGGAGTCAGCAACATGGCAGAAGACATCAAGACCAAAATCAAGAACTACCAGACTGCCCCTTTTGACAGCCGCTTCCCCAACCAGAACCAGACCAGGAACTGTTGGCAGAACTACCTGGACTTCCACCGCTGTGAGAAGGCAATGACCGCTAAAGGGGGTGATGTCTCCGTATGTGAATGGTACCGGCGTGTGTACAAGTCCCTCTGCCCCATATCCTGGGTGTCAACCTGGGATGACCGCCGGGCAGAAGGCACATTTCCTGGGAAGATCTGAACTGGCTTCACTCCACCTCTCCTCTGTCTTCCATCCCTCTCCCAGGGAAGCGAGGGTGGACCTGGGTACATCCCACCCTGGGATCCTAAATCGTGGTTTAACTAATAATAAATACTTGTTGGAAAAGTATAAGACTATGTGTGAAAGAGCTGGATGATGAGCAAGAAGCTAGGTTGGAAATAGTGCCTAGACCAGTAAGAGGGGCTTCAGAGTGATTATTTTTTTGTTTCATTTTGTTTTTAATTTTTATTTTATCAAACTTTGACCACTTCCTCTGTGCCAGACAGTAGAGTGAGTGATTATATGAAATAGACTCAAGCCCCTATATATGCTAAAATTTATCTGCATGTTCCTTTAATTATTTGTACATTTTTTAACATGTAATTTTTGAACCACATGAAAATAGTATAATAAAAACTCATATACCCATCGCCTAGCTTCAACAGTTATCAACAAATGACCAGTTTTATCTCTAATTACTCCCTTCCCCCCTAGACAATTTTAAAGTAAATCCTAGAGATCATATTTTATTCAGAAATAAGTGTATGTATCTCTTAGAGATACATGCTTTTAAAAACATAATCACAGTACTATTATTACACCTAAGAAATTAACAATTCATAATAATATCCAATAAGCAGTCTTTTGCACAGTGTGTAATTTCTCTCTATATTCTGGGCCTCTTTCATGTTGATCATGGTGATGATTGGAAGTCATTTAAGTAGGCTGAATTAAATGTTCTTTCTCAATGCCCCCAAAAGAATTGCCATACAATAACAACCCAAAATATTATCCACCAAACCTGTCAACAGGGAACTCCTAAGACAGTGTAACCAGCTAGAGCACCAAGGTGTGTGGCCAAATTGGTGTTTCTTCAAGACCATCCAAATGGTTATGCGACAGACTTATCTGAAAGATTTTCAGATGTGCAGAGGAAAGATGTGTATTGAGGAAAAATGGCACTAGGAAGGGATCTCCAATGGCAGCCTATGAGGAGAAGGGGCTGTAAACGAGACCCTCATGTATGCATAGTGACTTTGAGGGGCTGTAGAAGCTTCTGGCATGCATTGGAAATAGCAAAGAATTTAAAAAGGAATATGGTAATAATTTCAAAGGAAATGATATCCAATGAAAACTCAAGATGGGGGACTTGCCCTGGCCCCAGTCACATAATTCTGCCCAGAGGCTGCCAGCATTAACAGTTGCCCGTGTGTTCCTTCGGTTAGCCTGTACATGTAGAAGTGTTTCTGTATACATACTTTACATGTATTTGATTTGATAAAGTTTTGATATGGCTCTCCTGTTCCCTCACTGATC