Transcript asmbl_23091

Sequence
Transcript Sequence for observation asmbl_23091 of TGE0007464:
CTTCCGGCCTGTCTTAATTCCGCTTCCGGTCAAGCGGAATCGTCTTTGCTGAGGGTCACATTGAGCTGCGAGCTGTTTCAGGGGCGTCTTTAGGAGTCAGCAACATGGCAGAAGACATCAAGACCAAAATCAAGAACTACCAGACTGCCCCTTTTGACAGCCGCTTCCCCAACCAGAACCAGACCAGGAACTGTTGGCAGAACTACCTGGACTTCCACCGCTGTGAGAAGGCAATGACCGCTAAAGGGGGTGATGTCTCCGTATGTGAATGGTACCGGCGTGTGTACAAGTCCCTCTGCCCCATATCCTGGGTGTCAACCTGGGATGACCGCCGGGCAGAAGGCACATTTCCTGGGAAGATCTGAACTGGCTTCACTCCACCTCTCCTCTGTCTTCCATCCCTCTCCCAGGGAAGCGAGGGTGGACCTGGGTACATCCCACCCTGGGATCCTAAATCGTGGTTTAACTAATAATAAATACTTGTTGGAAAAGTATAAGACTATGTGTGAAAGAGCTGGATGATGAGCAAGAAGCTAGGTTGGAAATAGTGCCTAGACCAGTAAGAGGGGCTTCAGAGTGATTATTTTTTTGTTTCATTTTGTTTTTAATTTTTATTTTATCAAACTTTGACCACTTCCTCTGTGCCAGACAGTAGAGTGAGTGATTATATGAAATAGACTCAAGCCCCTATATATGCTAAAATTTATCTGCATGTTCCTTTAATTATTTGTACATTTTTTAACATGTAATTTTTGAACCACATGAAAATAGTATAATAAAAACTCATATACCCATCGCCTAGCTTCAACAGTTATCAACAAATGACCAGTTTTATCTCTAATTACTCCCTTCCCCCCTAGACAATTTTAAAGTAAATCCTAGAGATCATATTTTATTCAGAAATAAGTGTATGTATCTCTTAGAGATACATGCTTTTAAAAACATAATCACAGTACTATTATTACACCTAAGAAATTAACAATTCATAATAATATCCAATAAGCAGTCTTTTGCACAGTGTGTAATTTCTCTCTATATTCTGGGCCTCTTTCATGTTGATCATGGTGATGATTGGAAGTCATTTAAGTAGGCTGAATTAAATGTTCTTTCTCAATGCCCCCAAAAGAATTGCCATACAATAACAACCCAAAATATTATCCACCAAACCTGTCAACAGGGAACTCCTAAGACAGTGTAACCAGCTAGAGCACCAAGGTGTGTGGCCAAATTGGTGTTTCTTCAAGACCATCCAAATGGTTATGCGACAGACTTATCTGAAAGATTTTCAGATGTGCAGAGGAAAGATGTGTATTGAGGAAAAATGGCACTAGGAAGGGATCTCCAATGGCAGCCTATGAGGAGAAGGGGCTGTAAACGAGACCCTCATGTATGCATAGTGACTTTGAGGGGCTGTAGAAGCTTCTGGCATGCATTGGAAATAGCAAAGAATTTAAAAAGGAATATGGTAATAATTTCAAAGGAAATGATATCCAATGAAAACTCAAGATGGGGGACTTGCCCTGGCCCCAGTCACATAATTCTGCCCAGAGGCTGCCAGCATTAACAGTTGCCCGTGTGTTCCTTCGGTTAGCCTGTACATGTAGAAGTGTTTCTGTATACATACTTTACATGTATTTGATTTGATAAAGTTTTGATATGGCTCTCCTGTTCCCTCACTGATC