Transcript asmbl_230034

Sequence
Transcript Sequence for observation asmbl_230034 of TGE0006944:
GCCCCCGCACCTACTTCCCTGGTCCCCGTGCCGCGCGCGCCCCCGCGTGGCCAGCCCAGCCATTTGCTGGGTCCTGGAGGGAGGCGGCGGCCGCGTAGTCTTTCCTGCCCCTTGTCCGCCTCTTCTTCCTGCTCGCGGCCCGCCCGCCGGCTCGCACCCAGCCGCAGCGGCGTGGACGGAGGATACGACTGGGACGGCGCCGGGAGCCGAGGTGCTGAGGGACGGTGGCCGACTTAGGAGAGATGCTGGGCGTGGCGGCAGGAATGACCAACAGCAACATGGCCAATGCCCTTGCCAATGCTGCTTGTGAGCGCTGCAGGGGGGGTTTTGCACCCGCCGAGAAGATTGTAAACAGTAATGGCGAGCTGTACCATGAGCAGTGTTTTGTGTGTGCTCAGTGCTTCCAGCAGTTCCCAGAAGGACTCTTCTATGAGTTTGAAGGAAGGAAATACTGTGAACATGATTTTCAGATGCTCTTTGCTCCTTGCTGTCATCAGTGTGGCGAATTCATCATTGGCCGAGTTATCAAAGCCATGAATAACAGCTGGCATCCTGAGTGCTTCCGCTGTGACCTCTGCCAGGAAGTGTTGGCAGATATCGGGTTTGTCAAGAACGCTGGGAGACATCTGTGTCGCCCCTGTCATAATCGTGAGAAAGCCAGGGGCCTTGGAAAATACATCTGCCAGAAATGCCACGCCATCATTGATGAGCAGCCTCTAATATTCAAGAACGACCCTTACCATCCAGACCATTTCAACTGTGCCAACTGCGGGAAGGAGCTGACTGCTGATGCTCGGGAGCTGAAAGGAGAACTGTACTGCTTGCCGTGCCATGATAAAATGGGGGTCCCCATCTGTGGTGCCTGTCGACGGCCCATTGAAGGGCGTGTGGTAAATGCCATGGGCAAGCAGTGGCACGTGGAGCATTTTGTTTGTGCCAAGTGTGAAAAACCATTTCTTGGACATCGCCATTATGAAAGGAAGGGCCTGGCATATTGTGAAACCCACTATAACCAGCTATTCGGTGATGTTTGTTTCCACTGCAACCGTGTTATAGAAGGTGATGTGGTTTCTGCTCTTAATAAGGCCTGGTGCGTGAACTGTTTTGCCTGTTCTACCTGCAACACTAAGTTAACACTCAAGAATAAATTTGTGGAGTTTGACATGAAACCTGTCTGTAAGAAGTGTTATGAGAAATTTCCACTGGAGCTGAAGAAAAGACTTAAGAAACTAGCTGAGACCTTAGGAAGGAAATAATTTCCTTTATTATTTTCTTCTTTGCAAAGATCAGAGATTACCAACATTATTGATGTGATCTACCCTTATTTAAACCTATTTCTCAAAATAGTTGAGAGTGAAGAAAACCTACATGGTTTTCTTCATCTCTTTTTTTCTCATTAAAAAAGAAAATAAATTTGTGTAATCATATTTAAAACAGATAAAATCAAGATTTGCCTTTGTCAGTAATCATCAATTTGTTTAAGTATAGACTATACTTAATAGCAAAAATCACATAGCTAAATGTTAATTAAGGTCCAAAAATTTACATACAACTTTTTAAAAATGAAAGTAATGAGTCAGCTTTTATAAGACACAGCTAAAAAATATAAACTTTATTTTACTTTGTACTCAAAAGAAAATTAAATCCAACTGCTGTTAGGGACATTGTAGAGAAGAAAACTAACCAAGAAAAACAAATCTTATGGAATCTTAGTATGTTAATCAGACTGGTAGCTACAAAATGAATATACACATTACTAAGACAAGAAACAAGTATATTCAGAACTACTTGATTTTAGAGGTTTTTTGTTGTGAAATTCAATAATTATGCTGTTTTATATTTTGTTCTCCTTGTGAACTTCTTCTTTCATACAATTACTTAACATAGTTACGGCTAGCTTATAGTATGTTTTTTTTAATTTTGTGCAAAAAAAATTTATTCTATGTATTTGACAATACAGCATACTTTACAATATTGGAAAATGGAGTATTTTTTAATGTATTACAGCAATTATGTTTCTAAACATAAGGTCAAAGATGTAGTCTTAGAATAGGACATGAAATTAAATTTTATGTAGCTTGGATGTATCATTTAAAAAAAGTGAATGTATACGTATTGGTCATATTACCTTTATTATAACCATATTAATATCTATGCTTTATACATAACCTTGCCTTGTCTTAGAAAAACACATACCTTAATCAGGAATTCAAGCAGCTTCATATAATACCAACTAAAAATAGGTACACTGGTTGAGATTTATAAACTCAAATTTATTTGCCACAGCTACGATTATTTAAAAAAAATTTTTTTCTCCCTTTTTGGGAAACATTAAAATTAATTTCTGCCATCTTAGTATAAGAGAATGATGTTGATATGTTTCAAGTTTTTCACTTCAAATTTCATAATTAATTGAATTTATTTGCTATAAGTAAGAAGTATAAATGATACTTTTAAATTGGAAAAGGGATGTTTAAGTGTCAATTTTAGGTCAAAAAGTCATGAATTATTCTACTTTATCTTATTCTGAAGTTTCTGGACCATTCTTTCTCGATAAACTTGGATGCAAAGCAAACTTTGTGAACATTATTTAAATGTTGCTGTGTTATTTAAAAGAAAGTTGCCAAGATGGACTTCTAAAGGGAAAATGATTGTTTTCTCCAGAATTTTCTAAAATATTGTTTTGGCATTAAAAATATCTCAGGATGCTACTACTCTGCCATTAAAATATTTGTATGCATGTATTAAAAAGTATGCATGTACTTTATGAGATAAATTCTATTTCGGTTTTCAGATAACTTTATTTTTTAGTGTTCTTTTAGAGTTCAAAGAATTACAGAAGATTGAAATTAATCAATATATATAGTTAAGACTGCATGAGTTCTGAAGTTTCAAACAGTCTTTGCATTTGACAGTAAGAATCGAAATCCCTTCCATGTGCCTTTGTCAGCTAATTTATGACCAGCAGTGAAAACTTTAAAAGTATATAGGGTCTGGATGTTAAATTCTTAAATACCCTACACCAGAAATATGGAGCAGAAAAGTAACTATTTACCTATATCTTAATCACTTTGAAGATGCATGGACAGAACTCAGCTGCTTTGTTTACATATCTTACATAGACAGGTCTCTCCTATTGCCAGAGGTCCCACTGCTATCTTTGCTCACTCTTCTCTTAATATATGAATTAATATTTCTGAAAGTTCAACTTTTTAAGCCTCTAACACTTTAGGGTATTTTATGTAGATACAGTGCTTTCTTCCTCAATAGGGCTATCATTGGAACCCTTATATGTGGGAAAAGAGGAAGCAGTTGAAAAGTTCTAAGTGGAACAGAAGACAAACTTGGTTTAGTTCATACTATTTTTCATGGAGCTTTCTCTAGCTGTGGAAAAACTCAGGCTAGTAAGTATCTATTTAAAGTCTTGCAACGCAATTTTAAATAATTCATAGTTCTTACCATATTTCTAAATGCTCTTTTTCTTACCAAGCCTAATATAATTGGGAAAAAATGTCTGGATACAAATAAAACATTCTTTAGATCATGTTCAAAGCCTTATTAACATTGCACCTGAAATGACAGGCCACTCTGCCTCACTTATTTGCCAAAATGCCATTTCTAAGTTAAGGAAAATTTGAGGTAGGCTTACAGCATTCTTATTGTATTTACTTTTAGATTGTAAGCTCAATGGCAGGGGCACTATACTGATAATTATGTTTTTATATAGCAACCATTGCAGTATACTCTTGGTACTTAATAAAAATTCAGTATCCTACTGTGCATTGTTTAATTCGAATGGCTTTAAAACATATTACTATGAGAAGACAGGACTAATGTTTAAGAAAGCCCTTTTGAAAGCCACCTAGGTGGCCATCGATGGATAAGTGAATGGATAAAGAAAGCATGATGGGTAGGTAGGTAGGTAGGTGTGTGTGTGTGTGTGTGTGT