Transcript asmbl_2274

Sequence
Transcript Sequence for observation asmbl_2274 of TGE0001085:
GGACTTCCCCTACAGCCAGTACGTCTGCGTTCTGCCCTCCGGACGGCAGGGGGCGCGCGTCCTCCGCGGGCAAAGCGGAAGCGCTGGCGCACGCACGGCCGAGGGGCGGGGCACGTCCGCGAGCTCGCGATAACTGCGCAGGCGCAGAGTGGGCGGGCCTTTCCGAAGAACCGACAAGATGGCGGAAGTGGAGCAGAAGAAGAAGCGGACCTTCCGCAAGTTCACCTACCGCGGCGTGGACCTGGACCAGCTGCTGGACATGTCCTATGAGCAGCTGATGCAGCTGTACAGCGCCCGGCAGCGGCGGCGGCTGAACCGGGGCCTGCGGAGGAAGCAGCACTCGCTGCTTAAGCGTCTGCGCAAGGCCAAGAAGGAGGCACCGCCCATGGAGAAGCCGGAGGTGGTGAAGACGCACCTGCGGGACATGATCATCCTGCCGGAGATGGTGGGCAGCATGGTGGGCGTCTACAACGGCAAGACCTTCAACCAGGTGGAAATCAAGCCTGAGATGATCGGTCACTACCTGGGCGAGTTCTCCATCACCTACAAGCCGGTGAAGCACGGCCGGCCCGGCATTGGGGCCACGCACTCCTCCCGCTTCATTCCCCTCAAGTAGTCTGCTTGGCCAATAAAGGAC