Transcript asmbl_227356

Sequence
Transcript Sequence for observation asmbl_227356 of TGE0072719:
CGCATGCGCAGGTAGGCCCAGGAGGTCGCCGCCGCGGAAGCGAATCCACCTAGGGACGCCGCGCCGCTTGGCTGCTGCTGCGCCTGCGCAGGCGTGCCGGCGTCTGAGACTTCTTTGCCGCCGCCGCGGCTGCCGCGGATCTTCCCGGTGGCTTTGAGTCTCGCGCTTTCTTCGTTTGCTCGCTGGCGGGTTTGCGCCCCTCTCGCACCTTCGGGCGGTGAAGCTGGGGAAGGGGTTGGAGGGGGCTGTTGACTGCAGCCTTTAAGTTGTGCTCGGGGCGGCCATGTCGGCCGGCGAGGTTGAGCGCCTAGTGTCGGAGCTGAGCGGCGGGACCGGAGGGGATGAGGAGGAAGAGTGGCTCTATGGCGATGAAAATGAAGTTGAAAGGCCAGAAGAGGAAAATGCCAGTGCTAATCCTCCATCTGGAATTGAAGATGAAACTGCTGAAAATGGCGTACCTAAACCGAAAGTGACCGAGACTGAAGATGATAGTGATAGTGACAGTGATGATGATGAGGATGATGTTCATGTCACTATAGGAGACATTAAAACAGGAGCACCACAGTATGGGAGTTATGGTACAGCACCTGTAAATCTTAACATCAAGACAGGAGGAAGGGTTTATGGAACTACAGGAACGAAAGTCAAAGGAGTAGACCTTGATGCACCTGGAAGCATTAATGGAGTTCCACTCTTGGAGGTAGATTTGGATTCTTTTGAAGATAAACCATGGCGTAAACCTGGTGCCGATCTTTCTGATTATTTTAATTATGGGTTTAATGAAGATACCTGGAAGGCGTACTGTGAAAAACAAAAGAGGATACGAATGGGACTTGAAGTTATACCAGTTACCTCTACTACAAATAAAATTACGGCCGAAGACTGTACTATGGAAGTTACACCAGGTGCAGAGATCCAAGATGGCAGATTCAATCTTTTTAAGGTACAGCAGGGAAGAACTGGAAATTCAGAGAAGGAAACAGTGCTTCCATCTACAAAAGCTGAATTTACTTCTCCTCCTTCTTTGTTCAAGGCTGGACTCCCACCAAGCAGAAACAGCACCTCTTCTCAGTCTCAGACAAGTACTGCCTCCAGAAAAGCCAATTCAAGCGTTGGGAAGTGGCAGGATCGATATGGGAGGGCCGAATCACCTGATCTAAGGAGATTACCTGGGGCAATTGATGTTATTGGTCAGACTATAACCATCAGCCGAGTAGAAGGAAGGCGACGGGCCAATGAAAACAGCAACATACAGGTTCTTTCTGAAAGATCTGCTACTGAAGTAGACAACAATTTTAGCAAACCACCTCCATTTTTCCCACCGGGAGCTCCTCCCACCCACCTGCCGCCACCACCATTTCTTCCACCTCCTCCAA