Transcript asmbl_227340

Sequence
Transcript Sequence for observation asmbl_227340 of TGE0006898:
TAATTCCATTTTTCAGATGAGAAAAATCTGAGGCTCAGATAGGTAATGCACCAAGACCGAGGTTCTAGAACTAGTCAGAAGCTAAACTTAAGTCTAACAGATAGCCAGGTGCGCATGCTTGATAGTTAGTTTATACCTCTTAGCATAGAGGCTCAAAGAATAAAATTAATTACTTAAAGCCTAAAAACAGACATCTAAGAAAAGTCGATAACTCTCAACAGGGAGAAAAGGGGTTCCAGAACTTTCCTGCCAGCTGGTTTACTAGAAGACCGGAACGGAGCGTCACAACCGCCTGAAGCCAAGCCTTCCAGCGCGACAAAGGGGCCGGAGCAGGAGTTGGGGGGAACAAGACGGGGCTCCCCTTCCCGGCAGCTCGTGAGCGCCGCGGCCTGGGGGCGCAGGAACAAGGGCCGCAGAGAGGGAGACGGAGGCGCAGGCGCAGGCGTCTACTCGGGATGGCTCGCCTTAGACGCCGCGGGGAGTTCTGACGTCATTTCCTTCGCTAGTGTTTCCGGGTTGCGGTCATTTAGGGCCCGTATCTGGGTGACTTCTTGGTTGCCCAGTTGCTGTCGGCTCCCCACCCCCAGCTCCTGTGCGGTCCCGCGGGCCTCCCGATTTCGGCTTGCTTTCCCCCTTTCGGGACCTCCCTCTCCGGTTCCCTCTGGGCCTTCAGCCCCTGATTGCCCGGGCTTGCCGCGCCGTCGCTCGTCGCTGTTGTCTGAGGAAAGATGAATGGGAGGGCTGATTTTCGAGAGCCGAATGCTGAAGTTGCAAGACCAATTCCCCACATAGGGGCTGATTACATTCCAACAGAGGAAGAAAGAAGAGTCTTCGCAGAATGCAATGATGAAAGTTTTTGGTTCAGATCTGTGCCTTTGGCTGCAACAAGTATGTTGATTACTCAAGGATTAATTAGTAAAGGAATCCTTTCAAGTCATCCCAAATATGGTTCCATTCCTAAACTCATATTTGCTTGTATCATGGGATACTTTGCTGGAAAGCTTTCTTATGTGAAAACGTGCCAAGAGAAGTTCAAGAATCTTGAGAATTCCCCTCTTGGAGAAGCTTTACGATCAGGACAGGCACGACGATCTTCACCACCTGGACACTACTCTCAAAAGTCAAAATATGACTCAAATGTGAGTGATCATTCATCTTTTGTGACATCACCAGCAGCAGACAACATGGAAAAAGAGATGTTTTCTCATTATGAGCCAGTTCCATTCAGTGCTTCTATGAATGAATCTACTCCCACTGGTATAACTGATCATATTGCGCAAGGTAGAAACTTCTCTTGAAATGAATTTCAGCATTTTATGGTCCAACGTATGTATAAACTTTATTTGATGACCTTTTCTGCTGGATATCACCTATATGTTCCACCATCAGTCTAAACTCAGCATGTTTGTTCATTTCTTTCTTCATTCATTTAACATTTTTTTTTCATTTACTATTTTTGAGGTCCATTAGGTATCAGGCATTCTGCTAGCTATGTTAGAAGTAAATATGAATAAGACTTGGTTCTTTTCTCTGAGAAACTCTCTGTCAGTAAATATAGAAATATAAGGATAAATTACTAGTATGTCCCATCAGTTAAATACTAACCGGGTTTAGCAGAATAGCAGAGAAGTGATAAGTGCCTCAGGGGGAGGCTTTAAAAAGTTTACATTTGTTAAGCTGATCTTAAAGGCTTTCAGCTCCTTTGCTTGTAATATGAGAAAAATACTAATTACCTGCCTTTCAAAACTGTTGTCAGGTGAGAAAATCCATGAGAAAATGCTCTGTGAAGTTTATGTAAACTCTAGCTTTGAAAATCACATAAATGACAATACCTCTTTTAAAGAACTTTTGGAATGAGATGAAATAATCAGAGGTAACGCCTGGCAAGTAATAGGCTCTCAACAGACATTAGTTTCCTTCTTTTCTTCCATAAGTCTAATTTACAGTGAAAGGTGAGAAAGTATAGGTCTGCAATTTGTTACCTGAAATCCTAAAATCCAAAAAGCTTTGAAAACCGAAGTTTTTAAAAATAATTAAACAGGTGGTAAAGTCTGACCTAAACGCATTTCCAACCCTGACCTAAACTGACATAAGTTTAAATTCTGAGGAAGTCTGAATTTTGAAACATTTCTGACTCTTCAAGGATTTGGATAAGGGATTGTGGACCTCTATAGAGAATTCTTTGAAAATGCTTACTTTGAACCAAATACAATAAGCAAGCAATTAATGGGGAACAAACAGTGTTTAAAGGAACACTTTGATTTTTATTTCTTTTGTTTAAGTTGGGAGAGATTTGTGTGTGTGTGTGTGTGTAT