Transcript asmbl_227338

Sequence
Transcript Sequence for observation asmbl_227338 of TGE0006898:
TAATTCCATTTTTCAGATGAGAAAAATCTGAGGCTCAGATAGGTAATGCACCAAGACCGAGGTTCTAGAACTAGTCAGAAGCTAAACTTAAGTCTAACAGATAGCCAGGTGCGCATGCTTGATAGTTAGTTTATACCTCTTAGCATAGAGGCTCAAAGAATAAAATTAATTACTTAAAGCCTAAAAACAGACATCTAAGAAAAGTCGATAACTCTCAACAGGGAGAAAAGGGGTTCCAGAACTTTCCTGCCAGCTGGTTTACTAGAAGACCGGAACGGAGCGTCACAACCGCCTGAAGCCAAGCCTTCCAGCGCGACAAAGGGGCCGGAGCAGGAGTTGGGGGGAACAAGACGGGGCTCCCCTTCCCGGCAGCTCGTGAGCGCCGCGGCCTGGGGGCGCAGGAACAAGGGCCGCAGAGAGGGAGACGGAGGCGCAGGCGCAGGCGTCTACTCGGGATGGCTCGCCTTAGACGCCGCGGGGAGTTCTGACGTCATTTCCTTCGCTAGTGTTTCCGGGTTGCGGTCATTTAGGGCCCGTATCTGGGTGACTTCTTGGTTGCCCAGTTGCTGTCGGCTCCCCACCCCCAGCTCCTGTGCGGTCCCGCGGGCCTCCCGATTTCGGCTTGCTTTCCCCCTTTCGGGACCTCCCTCTCCGGTTCCCTCTGGGCCTTCAGCCCCTGATTGCCCGGGCTTGCCGCGCCGTCGCTCGTCGCTGTTGTCTGAGGAAAGATGAATGGGAGGGCTGATTTTCGAGAGCCGAATGCTGAAGTTGCAAGACCAATTCCCCACATAGGGGCTGATTACATTCCAACAGAGGAAGAAAGAAGAGTCTTCGCAGAATGCAATGATGAAAGTTTTTGGTTCAGATCTGTGCCTTTGGCTGCAACAAGTATGTTGATTACTCAAGGATTAATTAGTAAAGGAATCCTTTCAAGTCATCCCAAATATGGTTCCATTCCTAAACTCATATTTGCTTGTATCATGGGATACTTTGCTGGAAAGCTTTCTTATGTGAAAACGTGCCAAGAGAAGTTCAAGAATCTTGAGAATTCCCCTCTTGGAGAAGCTTTACGATCAGGACAGGCACGACGATCTTCACCACCTGGACACTACTCTCAAAAGTCAAAATATGACTCAAATGTGAGTGATCATTCATCTTTTGTGACATCACCAGCAGCAGACAACATGGAAAAAGAGATGTTTTCTCATTATGAGCCAGTTCCATTCAGTGCTTCTATGAATGAATCTACTCCCACTGGTATAACTGATCATATTGCGCAAGGTAGAAACTTCTCTTGAAATGAATTTCAGCATTTTATGGTCCAACGTATGTATAAACTTTATTTGATGACCTTTTCTGCTGGATATCACCTATATGTTCCACCATCAGTCTAAACTCAGCATGTTTGTTCATTTCTTTCTTCATTCATTTAACATTTTTTTTTCATTTACTATTTTTGAGGTCCATTAGGTATCAGGCATTCTGCTAGCTATGTTAGAAGTAAATATGAATAAGACTTGGTTCTTTTCTCTGAGAAACTCTCTGTCAGTAAATATAGAAATATAAGGATAAATTACTAGTATGTCCCATCAGTTAAATACTAACCGGGTTTAGCAGAATAGCAGAGAAGTGATAAGTGCCTCAGGGGGAGGCTTTAAAAAGTTTACATTTGTTAAGCTGATCTTAAAGGCTTTCAGCTCCTTTGCTTGTAATATGAGAAAAATACTAATTACCTGCCTTTCAAAACTGTTGTCAGGTGAGAAAATCCATGAGAAAATGCTCTGTGAAGTTTATGTAAACTCTAGCTTTGAAAATCACATAAGTAAGTGAACAATATCAACTTTGGATTAAGGCCTGGATTTGATTCATGATTGACATTTACTAGCTCTATGACTTTTGGCAAGTAACTAATTTGTGATCCCTTCAATTTCTTGATCTCTTGAATGCAGATGACAATACCTCTTTTAAAGAACTTTTGGAATGAGATGAAATAATCAGAGGTAACGCCTGGCAAGTAATAGGCTCTCAACAGACATTAGTTTCCTTCTTTTCTTCCATAAGTCTAATTTACAGTGAAAGGTGAGAAAGTATAGGTCTGCAATTTGTTACCTGAAATCCTAAAATCCAAAAAGCTTTGAAAACCGAAGTTTTTAAAAATAATTAAACAGGTGGTAAAGTCTGACCTAAACGCATTTCCAACCCTGACCTAAACTGACATAAGTTTAAATTCTGAGGAAGTCTGAATTTTGAAACATTTCTGACTCTTCAAGGATTTGGATAAGGGATTGTGGACCTCTATAGAGAATTCTTTGAAAATGCTTACTTTGAACCAAATACAATAAGCAAGCAATTAATGGGGAACAAACAGTGTTTAAAGGAACACTTTGATTTTTATTTCTTTTGTTTAAGTTGGGAGAGATTTGTGTGTGTGTGTGTGTGTAT