Transcript asmbl_218111

Sequence
Transcript Sequence for observation asmbl_218111 of TGE0006717:
CAGGAAGTGGCTCCGGGGCGCATGCGCCTCGTCTCCACGGTACTTGAAGTAGTTTCCTCCGCCGGCGTCTCGGGACCCCGGCTCTCAGGATTCCGGTTCGCGGCTTCTCGCCCTCTCCCCTTCCTCGGCGCAGCGGCTTCGCAGGCTCCAGAATCCTCCTGCTCCTCGCAGCCGGCCTCCCTCCGCGGCGCGACTCTCAGGGCCACGATGAGTTTGTTTGGAACAACGTCAGGTTTCGGAACTGGTGGGACCAGCATGTTTGGCAGCACAACCACGGACAACCACAACCCTATGAAGGATATTGAAGTAACATCCTCTCCTGACGATAGCATCGGTTGCCTGTCTTTTAACCCACCAACGTTGCAGGGGAACTTTCTCATTGCAGGATCGTGGGCTAACGATGTTCGCTGCTGGGAAGTTCAGGACAGTGGGCAGACGATCCCTAAGGCCCAGCAGATGCACACGGGGCCTGTGCTGGGGGTGTGCTGGAGCGACGATGGGAGCAAAGTATTTACGGCTTCGTGTGATAAAACTGCCAAAATGTGGGACCTTAACAGTAATCAAGCCATACAGATTGCACAGCACGATGCTCCTGTTAAAACCATCCACTGGATCAAAGCACCAAACTACAGCTGTGTGATGACCGGGAGCTGGGATAAGACGCTGAAGGCACGTGGGGTACCCTGGCCGGGCTGCCATCCGTGCTAGCACTGTGGGCTTCCGCTCTGAGTGGGCACGCCCTGGCTTTCTCTTTTTTTCCTTTTAGTTTTGGGATACGCGATCATCAAATCCTATGATGGTTTTGCAACTCCCTGAAAGGTGTTACTGTGCCGACGTGATATATCCTATGGCCGTGGTGGCCACTGCAGAGAGAGGACTGATTGTCTATCAATTAGAGAACCAACCTTCTGAATTCAGGAGGATAGAATCCCCACTGAAACACCAGCATCGATGTGTGGCTATTTTTAAAGACAAACAGAACAAGCCGACTGGTTTTGCCTTGGGAAGTATCGAGGGGAGAGTTGCTATCCACTACATCAACCCCCCGAATCCAGCCAAAGATAACTTTACCTTTAAATGTCATCGATCTAACGGAACCAATACTTCAGCTCCTCAGGATATCTACGCGGTCAATGGAATCGCGTTCCATCCTGTTCATGGTACACTTGCCACGGTGGGATCTGATGGCAGATTCAGCTTTTGGGACAAAGACGCCAGAACAAAACTTAAAACTTCAGAACAGTTAGATCAACCGATATCGGCTTGCTGCTTCAATCACAATGGAAACATATTCGCATATGCTTCCAGCTACGACTGGTCAAAGGGACATGAATTTTATAATCCCCAAAAGAAAAATTACATTTTCCTGCGTAACGCAGCCGAAGAGCTGAAGCCCAGGAACAAGAAGTAGGGGAGCCTCCTGGCTGCCACAGCGCCTTCCTCTCCACTCTGCCTCGTCTCACGAACTTGGGTCCCAGCTTTTTGTGGGTTCAGCCATGGATGTGGATTCCAACCCTCGGGGAAAACTGTCATTGTTTGGCAGTCGGGCCCAGCGGGCCACAGTGACCGTTGGTCTCTCCATTCCACTGCCCATTACAGACGTCTCTGGAACTGTGAGGGGGTTGGAGTCGCTGTAGAAGTTAGGTCCCTGCGGGCGACTGCCAGGCATTCGCAGTCTTCGCTCAGCAGCGTGTGTATAGAGAACACTGGGAATCATTTTGTGAACCCTGGACTGTATTTTGTAATAAAGCATTTCGAAGATTGTCTCCTAAGCTCACTGTGTCCACCTTGCCCGCCCGCCCGCCCAGTGAGCTCTGACGTCATCCTATGCAACACCATCGTTGGGGTTTGATTGGCGACTTCAGATGCCCTTTGGGAAATGCAGAAATCTTGCACCTCGGGAAAGAGGGCGTCCTGAGCCGTGACTGCCACGTGGGATGTGTAGCCACAGCCTCTCCCAGCGTCGGCGGGCGGCTCGAAGGCAGTTTTCTCTCCGCCCTTCGTTCCTGTCTGTAAATCCCCACTGGTTTTCCACTCTGCTGGGCAGCTGTCCTGTGACAAACGGGAGTGTTCCTTGTGCTAAGGGACAGGCCTCTGTGGGCAGGGCCCGAGGGGGGCAGTGTTTGAACCCCCACCTCCTGCCTGGGCCAGCACTCTGCTCCTGTGCCCGGTGGTGGTAGTCTGGACTGCTTTTTTATTTCATGTAATTTAAAATTCCCGATTGGTAAGTATCGGATGAAATTCAGTTTAGTATTTGACTTTTGAGTCTCTTGCTGTGTTTTTGCCCTGTCATCTCAAATGCTTCTTATGCTTTACTATTTGAGGCTGGTATGTAAACTAATTTGCTGAGTATGAAAATCTGTCATCAATAATGTAAGATGTGTTTGCCTACTCATAAAAAGCAATGACAATAAAATTTTCTACTGGAAAAAAA