Transcript asmbl_21713

Sequence
Transcript Sequence for observation asmbl_21713 of TGE0007136:
GCGCGGGCGGCGCTCTGTACCCGGAAGCCCGCGGTGTCCGGTCCCAGCCTTCTCTGGGAGCGGGCGGTGGGCAACGCCGGGGTGACCCGCGCCCCTCGTTCTTGAGCCCGCGCGCTCTGAGAGGGTGCTCGGACAGATTGAAGCCATGGCTATTCTTTTTGCCGTCGTTGCCAGGGGAACCACCATCCTTGCCAAACACGCTTGGTGTGGAGGAAACTTCCTGGAGGTGACAGAGCAGATTCTGGCTAAGATACCTTCTGAAAATAACAAACTAACGTACTCACACAGCAACTATTTGTTTCATTACATCTGCCAAGACAGGATCGTGTACCTTTGTATCACTGATGATGATTTTGAACGTTCCAGAGCCTTTAATTTTCTGAATGAGATCAAGAAGAGATTCCAGACCACGTATGGTTCAAGGGCACAGACAGCACTCCCATATGCCATGAACAGTGAGTTCTCAAGTGTCTTGGCCGCACAGCTGAAGCATCATTCTGAGAATAAGGGCCTAGACAAAGTGATGGAGACTCAAGCCCAAGTGGATGAACTGAAAGGAATCATGGTCAGAAACATAGATCTGGTAGCTCAACGAGGAGAAAGATTGGAATTATTGATAGATAAAACAGAAAATCTCGTGGATTCGTCTGTCACCTTCAAAACAACCAGCAGAAACCTTGCCCGAGCCATGTGCATGAAGAATCTCAAGCTCACCATCATCATCATCGTCGTATCAATCGTGTTCATCTACATCATCGTGTCACCTCTGTGTGGTGGATTTACATGGCCCCGCTGTGTGTAAAAATAGAAAAGACAAAGTTATTCACCGGACGACACGAGAGAACAAGGAGTTAAAAGGCCGAATGATCTAAACCTTTCACTACTGACAGATGGCGTCTGCCAGTCTCTTCAGCCCTCTCTTTCTCTTTCTGTTTTTAATCCTGTTCTATGCATCCAGATTTATCTTTGTCCTCTCAGTCAGTTTATTCCAGTGTACTTCAAAATGAACCATTTATTGCAGCAGTAGCCTTAAAAAGGCTTTTGTCCGTTCCTTTGGTTTGTTCACTAGTATTATAGACTCAGAGAAACGTTTTCGTCGGTGATTGCACAAAGCCATCGCCAAGGTGGAAAACACCAGTCTTGTAAACTGCCTGCTAAAACTGTAGCTGAACATTGTACGTGCACAGAAAAGTATTCGAGAGACACGTATTGCTACCATCTCATGTTTATGTCTTTTGGTATTGAGGAGTTTTAGATGCTCGAAAACAATACGAATGGAGAATTACTGTTATTTGGGGAATTGTAATTCAATTGTTGGTGCTGCCTGCTTCTAGCAGCCCAAGCAGATAAAGTATTAGACATTCTGTCTTGGTCAGAGGGAGAATATTTTTAGAAGCACGTGGAATTATGTTCGACTTCCTAGTACTCACTTTCAGGAAGAAAGATTTGACCATTTGCAAACCTCACAGAGCTCAGTAGCTTCTGTTTCCCCGTTGCAGTTGATTTGAGAAGATAATGGTTTAAATATGGCCGAAGGTTATGGTTTTCCACATATTTCTTTGGTCCTCAGTTGATTTTTAGAGCCATTCTATAGTTAATAGAATAGACAGTGGAGGGGGTGGGGAGGCACCACAGAGGACACGCTAACGTTTTAGCTCTGTGAATGGAGGCAGCGTGGGAAGGTTTTTCCTTTCTGGGAAAAGCCCAAACAGAACATGGTCAGCTCCAGGGTTTGGGTCTGGCTGCTGTCGAATAATAATAGTCTGAGCATCCTTTGTGGTTCAGTAAGTTCTTTAATCTGCCTACTTTTGAAGAATTCTTTCGTGAAACGAGAGTAGGCACGACGATGTCTAGAAACAACGCAAGACAGTTCAGCATCCATTTAACTGCACTGTAGGAAAACTGCTGTGGATGCTTCGCTTCGGCGACTGTGACGTCTCTCTGCTGGTGTGTACTTTTGGTGTGTATCTGGAAGGACATTTACTGCTCTGGATCTAACTGCATTTATTGATCAATAAATGCCAGTAAGCAGAAATTCTATTATATTCGACTATTTTCCCAATAAAAGAACAAATCAGTCTGTAAAACCTAGCCACCTGTTTAGCCTAGTCACGTGCCTTGAATATATATGTGTCATATAACCTGGCTGATGCTACCTGTTCTTCCACGTAAACCTTTCGGTTCATTAATTGGACACGGATTTCAGGCCCACTGGAACGCTTTTCCTGGCGACCATGCATTCTACAAATGTTCTCTTTATCAACACTAATGCCTTTTAATTGCATCAGCATTTCCTACTGGAAAACACATTTGTTCCAGGAAAACATTTGCCATTCCTGAATAATAATTTCCAAATGTCTTTAATCCAAAGAAGAGGACTTAAAGTGGATTTCCCTTTCGTATACACGACTGAATAAAAATGATGTGCATGTCTTAGGGATAAATGACTTAACTGTCCCTCGATCTGTTTATGTATAAGAATGCTTTTTAAAGCACATATCTTGTTTTAAATGACGCACAAACTGAAGGCATTAATAAAATTTAAGAGTAATACAA