Transcript asmbl_216958

Sequence
Transcript Sequence for observation asmbl_216958 of TGE0006790:
CCAGCAGCAGCAGCAGCAGCAGCCCCCCACCCTTCCCGAATACGAGCACCACAGGGGCCCGGAAGCCCGCACAGGCGTTTAGAGAACATGGCAGACGATATTGATATTGAAGCAATGCTTGAGGCTCCTTACAAGAAGACTTGCCTAACGATATCTCACCTCTACTCCCATGAATTCACCTTTGATTCCAGTGTGAACTGTCAATCATAAGGATGAGAACAAGTTGAGCAGTGCTAATGGCCATGAAGAACGTAGCAAAAAGAGGAAAAAAAGCAAGAGCAGAAGTCGTAGTCATGAACGAAAAAGAAGCAAAAGTAAGGAACGGAAGCGAAGCAGGGATAGAGAAAGGAAAAAGAGCAAAAGTCGTGAAAGGAAGCGAAGTAGAAGCAAAGAAAGGAGACGGAGCCGCTCAAGAAGTCGAGATCGCAGATTCAGAGGCCGCTACAGAAGTCCTTACTCCGGACCAAAATTTAACAGTGCCATCCGAGGAAAGATTGGGTTGCCTCATAGCATCAAATTAAGCAGACGACGCTCCCGAAGCAAAAGTCCATTCAGAAAAGACAAGAGTCCTGTGAGGGAACCAATTGATAATCTAACTCCTGAGGAAAGAGATGCAAGGACAGTTTTCTGCATGCAGCTGGCAGCAAGAATTCGGCCAAGGGATTTGGAAGAGTTTTTCTCTACAGTTGGGAAGGTTCGAGATGTAAGGATGATATCTGATAGAAATTCAAGACGTTCCAAGGGCATTGCTTATGTGGAGTTTGTCGATGTTAGCTCAGTGCCTCTAGCAATAGGATTAACTGGCCAACGTGTTTTAGGAGTGCCAATCATAGTACAGGCGTCACAGGCGGAAAAAAACAGAGCTGCAGCAATGGCAAACAATCTACAAAAGGGAAGTGCTGGACCTATGAGGCTTTATGTGGGCTCCTTACACTTTAACATAACTGAGGATATGCTTCGGGGGATCTTTGAACCTTTTGGCAGGATTGAAAGTATCCAGCTCATGATGGATAGTGAAACAGGTCGATCTAAGGGATATGGATTTATTACGTTTTCCGATTCAGAATGTGCCAAGAAGGCTTTGGAACAACTTAATGGATTTGAGCTGGCAGGAAGGCCGATGAAAGTTGGACATGTTACTGAACGTACTGATGCTTCCAGTGCTAGCTCATTTTTGGACAGTGATGAATTGGAAAGGACTGGAATTGACCTGGGAACAACTGGTCGTCTCCAATTAATGGCAAGACTGGCAGAGGGTACAGGTTTGCAGATCCCACCAGCAGCACAGCAAGCTCTACAGATGAGTGGCTCTTTGGCATTTGGTGCTGTGGCAGATTTGCAAACAAGACTTTCTCAACAGACTGAAGCTTCAGCTTTAGCTGCAGCTGCCTCTGTTCAACCTCTTGCAACACAGTGTTTTCAACTCTCTAACATGTTTAACCCTCAAACAGAAGAAGAAGTTGGATGGGATACAGAGATTAAAGATGATGTGATTGAAGAATGTAATAAACACGGAGGAGTTATTCATATTTATGTTGACAAAAATTCAGCTCAGGGCAACGTGTATGTGAAGTGCCCATCAATTGCTGCAGCCATTGCTGCTGTCAATGCATTACATGGCAGGTGGTTTGCTGGTAAAATGATAACAGCAGCATATGTACCTCTTCCAACTTATCACAACCTCTTTCCTGATTCTATGACAGCAACACAACTACTGGTTCCAAGTAGACGATGAAGGAAGATATAGTCCCTTATGTACATAGCTTTTTTTCTTTCTTGAGAATTCATCTTGAGTTATCTTTTATTTAGATAAAAATAAAGAGGCAAGGGTCTACTGTCATTTGTATACAATTCCTGTTATCTTGAAAAAATAAAAATGTTAACAGGAATGCAGTGTGCTCATTCTCCCTAACTAGCAATTCCCACTGTATACAAAGCTGTTCTCTAGTTCTGCCTTTTAAATGTACATGTAGAAAATTACATTAAGGATCTATAGAAATAGCTCTAGGGGAACAAATGTGCTTAATGTAAAAAGGCAGACAGGGATGTAATGATGTTTTTAATGTTTCAGAAGCCTAACTTTTTACACAGCAGTTACATTTCTCATTCACTAATGTTGATATTTGGCTAATGGTTTAGCAGAGGTTTCTGGAATACACTTTTAGTGAATGGAAATTGAAGACAGCTAAAGGGCTGTTGATTAACATCTCATCTTGCATTCTGGTCAATTGGCAAGAAAAGGAGATTTCAAAATTAACATTTCTGGATGGTATCTTTTCAATTAATGTATCTGTAAAAGTTTCTTTGTAAATATGTGTTCTAGTGTGTCTAAGATTCCAAACAAAATGATCCCTGCATTTCCTCAAGATGTTTAGTGACAGTCTGGTAAGGAAAGAAATAGGAAATGCAGAAATAGGTTTTGTCTGGTTGCATATCTTTGCTCTTTTTAAGCTCTGTGAGCTCTGAAATATATTTTTGGGTTACTTCAGTGTGTTTGACAAGACAGCTTGATATTTCTATCAAACAAATGACTTTCATATTGCAACAATCTTTGTAAGAACCACTCAAATAAAATTCTCTTAAAAAGGCCATAAGAAAATCTTCATTTTTGAAATGTTTTAAAGTCATAGAAACTTGAAAATAGAATACTAGTTTCTTTGACTCGGTATTTGCCTCTTTGGGAAAATTCTTAGCATGCAGAGTCTGGATATATTTGCCCTCAAGTTGTCCCTGTAAATTGCTCCATATCACTATATTATAGTACTATAGTTATCTTAGGACAATGGATCAAAACTGAGGGATTTACCAAAAAGAATTCACTCAGGCCTTAAACCTGGGTGTTCTTAAAGTCTCCTGTGTTATCTGGGCATCTTGGTGAAAAAAATAAAAATAAAAATGCTTTACTATTTAAATACTGAACAAAAAATGGTCTAAATTCAAACTGGTTTCCCAAATTTAATTGCATTTTACTTTATTATGGGACTTTGAGCTTTAACTTGGGTAGTGAGCCTTCACCATTTATACTCTGCACTCTGCTTCAAATTCTGTCTACGTTGAAACTTGGAGTAGGCAATGTTGCTCCTAAATGGAATGATCACCTTCAAATACTGGTTTCCTCACCTTGTTTCTATTGATAGCGCTGATGCATAAGTTTTATAGGTTTATTCAGATAAGATATTTAATCAATTTGAGTATGGTGGCATCAGTTTTCCACCAACCATTTTGACATATTTAATCCAAAATTCCTTGCTTCAGTTAACTTGAACATTTTTAAAATTAAAAATGATTTTTCAACATTGGGCAGCAGTTTCTTGGAGCTGACTTATCCTGACAGTGTTTTCTTTCCAAAGTATCTCCATAATTAAACTTTTAATTCTTGAATCAAGTCCAGTCAGGTGGTCATTCTTTCTTAGGGAATTGAATTGGGTCAGCAGAGGTGGC