Transcript asmbl_216956

Sequence
Transcript Sequence for observation asmbl_216956 of TGE0006790:
CCAGCAGCAGCAGCAGCAGCAGCCCCCCACCCTTCCCGAATACGAGCACCACAGGGGCCCGGAAGCCCGCACAGGCGTTTAGAGAACATGGCAGACGATATTGATATTGAAGCAATGCTTGAGGCTCCTTACAAGAAGACTTGCCTAACGATATCTCACCTCTACTCCCATGAATTCACCTTTGATTCCAGTGTGAACTGTCAATCATAAGGTAGTAATTGAGTGACTTATCGCTGTACCGTGGTCCCCTAGGTAAAATGACTCAACTAAGAATTACCAGCTCCAGTTTGGTATAGCAAAAAGGTGAATGTAGTGGTTTGGGAAAATAGCAGGGGTCCAAGAATAACAAAGCATAACCAGTCTGTGGCAAGCAAATCTTTAAATAAAAGTCTTACAAGAAGAAATGGGTGAGATTTAAAATTTTTTCTATGTATTAAAGACTGGTGATAGTAAAATATTAAAACAGGCAGGTGAAGATCTGCTGTTCAGTTAAAAATTACTAAAATTCTTGGATCCCTGAAGAGAAAAAAATTTAAACAAAAAAGGCAGTATCACAACTTATAGTCACTTGATGACTGTTTTACTGTTCTCCATATTGTTTTATTTTTAATTAGTCCCTGCCATATTTCACACTAGAAACTACAAAGGAATTATTTTAGCTAATATAGCCTTTGACCCATTTCAGTATCACAGTAAAAGTAAAGTGTCTTTTCATTCTTTCACCAGTTGGTGGTGAAAATAGCAGTATGCATGCATTATCACTGGTGTCACAAACTAAGCTTTGTAAGTTAGCAGTTATACTCCTGTAACTGATGTGATCAACTTTAATAAACATTGCGCTAAACCTTTTAAAAATAATTCATTTATTTTGGAGTGTATAGCACGACCATGTGGTACCAATTTGGATGAATTCTTTGTAGCTTTAAATAGTGTACATAGTTTTTTAATGCTTAGACTCTTGAAGAGCTACTTTCTATTTTAATGTTAAGATTCTTGTGTCTTAGTTTAACGTGGATGTAATTCCATGTAAACAGGTATGGAAGTAGGAAATGTTTAGGCTGGACTGGTGGATTATTAATTGACTTTCTTGGGTTCTTGGGAGTCAACATTACTAAAGCAGTGTGAATCCCTGTTTGCTTCAGGGCGAGATGTGTGACAGAGGTGGCATCAAGCTCTTACAGTCCCAACCCTCCAACGGAAATGGGCGAAGATCTCAGGAATGGCATCGGTCACAGGAAATCGATAGTGGCTGGCTGCTAGCATGGCCACTTGGGGCTTAGGCAGAAATAGAGCCATGGTACTGACCAAAGGGACCATAGCACATGGAATAAAACTCAAAACAGGACTTCATTCATGTTTTAAAGAAATTCTATTTAACCACTTCAACACTAAATCTGGAATACTTAATATCTATATAAGAAAGTAAAATTTAACATGTTAATATGTATTTTTATTTTTGTATTTTGATGACTTAATTGTAAGCAACAAAGTGGTTAAACAACACATATCCATCTAAATTTTTTTATAGCCTTCCATGTTAAACTATAAATAAGTAATTAGTTTTAAAATTGTTTTGTATTTTCTTATTCCTGTTCCCTTTACCCTTTGACAACTTGAAATGTTACCACTTCGTCCTCATGATGTTCTTCTATCAACCCTGCTTAGGATGAGAACAAGTTGAGCAGTGCTAATGGCCATGAAGAACGTAGCAAAAAGAGGAAAAAAAGCAAGAGCAGAAGTCGTAGTCATGAACGAAAAAGAAGCAAAAGTAAGGAACGGAAGCGAAGCAGGGATAGAGAAAGGAAAAAGAGCAAAAGTCGTGAAAGGAAGCGAAGTAGAAGCAAAGAAAGGAGACGGAGCCGCTCAAGAAGTCGAGATCGCAGATTCAGAGGCCGCTACAGAAGTCCTTACTCCGGACCAAAATTTAACAGTGCCATCCGAGGAAAGATTGGGTTGCCTCATAGCATCAAATTAAGCAGACGACGCTCCCGAAGCAAAAGTCCATTCAGAAAAGACAAGAGTCCTGTGAGGGAACCAATTGATAATCTAACTCCTGAGGAAAGAGATGCAAGGACAGTTTTCTGCATGCAGCTGGCAGCAAGAATTCGGCCAAGGGATTTGGAAGAGTTTTTCTCTACAGTTGGGAAGGTTCGAGATGTAAGGATGATATCTGATAGAAATTCAAGACGTTCCAAGGGCATTGCTTATGTGGAGTTTGTCGATGTTAGCTCAGTGCCTCTAGCAATAGGATTAACTGGCCAACGTGTTTTAGGAGTGCCAATCATAGTACAGGCGTCACAGGCGGAAAAAAACAGAGCTGCAGCAATGGCAAACAATCTACAAAAGGGAAGTGCTGGACCTATGAGGCTTTATGTGGGCTCCTTACACTTTAACATAACTGAGGATATGCTTCGGGGGATCTTTGAACCTTTTGGCAGGATTGAAAGTATCCAGCTCATGATGGATAGTGAAACAGGTCGATCTAAGGGATATGGATTTATTACGTTTTCCGATTCAGAATGTGCCAAGAAGGCTTTGGAACAACTTAATGGATTTGAGCTGGCAGGAAGGCCGATGAAAGTTGGACATGTTACTGAACGTACTGATGCTTCCAGTGCTAGCTCATTTTTGGACAGTGATGAATTGGAAAGGACTGGAATTGACCTGGGAACAACTGGTCGTCTCCAATTAATGGCAAGACTGGCAGAGGGTACAGGTTTGCAGATCCCACCAGCAGCACAGCAAGCTCTACAGATGAGTGGCTCTTTGGCATTTGGTGCTGTGGCAGATTTGCAAACAAGACTTTCTCAACAGACTGAAGCTTCAGCTTTAGCTGCAGCTGCCTCTGTTCAACCTCTTGCAACACAGTGTTTTCAACTCTCTAACATGTTTAACCCTCAAACAGAAGAAGAAGTTGGATGGGATACAGAGATTAAAGATGATGTGATTGAAGAATGTAATAAACACGGAGGAGTTATTCATATTTATGTTGACAAAAATTCAGCTCAGGGCAACGTGTATGTGAAGTGCCCATCAATTGCTGCAGCCATTGCTGCTGTCAATGCATTACATGGCAGGTGGTTTGCTGGTAAAATGATAACAGCAGCATATGTACCTCTTCCAACTTATCACAACCTCTTTCCTGATTCTATGACAGCAACACAACTACTGGTTCCAAGTAGACGATGAAGGAAGATATAGTCCCTTATGTACATAGCTTTTTTTCTTTCTTGAGAATTCATCTTGAGTTATCTTTTATTTAGATAAAAATAAAGAGGCAAGGGTCTACTGTCATTTGTATACAATTCCTGTTATCTTGAAAAAATAAAAATGTTAACAGGAATGCAGTGTGCTCATTCTCCCTAACTAGCAATTCCCACTGTATACAAAGCTGTTCTCTAGTTCTGCCTTTTAAATGTACATGTAGAAAATTACATTAAGGATCTATAGAAATAGCTCTAGGGGAACAAATGTGCTTAATGTAAAAAGGCAGACAGGGATGTAATGATGTTTTTAATGTTTCAGAAGCCTAACTTTTTACACAGCAGTTACATTTCTCATTCACTAATGTTGATATTTGGCTAATGGTTTAGCAGAGGTTTCTGGAATACACTTTTAGTGAATGGAAATTGAAGACAGCTAAAGGGCTGTTGATTAACATCTCATCTTGCATTCTGGTCAATTGGCAAGAAAAGGAGATTTCAAAATTAACATTTCTGGATGGTATCTTTTCAATTAATGTATCTGTAAAAGTTTCTTTGTAAATATGTGTTCTAGTGTGTCTAAGATTCCAAACAAAATGATCCCTGCATTTCCTCAAGATGTTTAGTGACAGTCTGGTAAGGAAAGAAATAGGAAATGCAGAAATAGGTTTTGTCTGGTTGCATATCTTTGCTCTTTTTAAGCTCTGTGAGCTCTGAAATATATTTTTGGGTTACTTCAGTGTGTTTGACAAGACAGCTTGATATTTCTATCAAACAAATGACTTTCATATTGCAACAATCTTTGTAAGAACCACTCAAATAAAATTCTCTTAAAAAGGCCATAAGAAAATCTTCATTTTTGAAATGTTTTAAAGTCATAGAAACTTGAAAATAGAATACTAGTTTCTTTGACTCGGTATTTGCCTCTTTGGGAAAATTCTTAGCATGCAGAGTCTGGATATATTTGCCCTCAAGTTGTCCCTGTAAATTGCTCCATATCACTATATTATAGTACTATAGTTATCTTAGGACAATGGATCAAAACTGAGGGATTTACCAAAAAGAATTCACTCAGGCCTTAAACCTGGGTGTTCTTAAAGTCTCCTGTGTTATCTGGGCATCTTGGTGAAAAAAATAAAAATAAAAATGCTTTACTATTTAAATACTGAACAAAAAATGGTCTAAATTCAAACTGGTTTCCCAAATTTAATTGCATTTTACTTTATTATGGGACTTTGAGCTTTAACTTGGGTAGTGAGCCTTCACCATTTATACTCTGCACTCTGCTTCAAATTCTGTCTACGTTGAAACTTGGAGTAGGCAATGTTGCTCCTAAATGGAATGATCACCTTCAAATACTGGTTTCCTCACCTTGTTTCTATTGATAGCGCTGATGCATAAGTTTTATAGGTTTATTCAGATAAGATATTTAATCAATTTGAGTATGGTGGCATCAGTTTTCCACCAACCATTTTGACATATTTAATCCAAAATTCCTTGCTTCAGTTAACTTGAACATTTTTAAAATTAAAAATGATTTTTCAACATTGGGCAGCAGTTTCTTGGAGCTGACTTATCCTGACAGTGTTTTCTTTCCAAAGTATCTCCATAATTAAACTTTTAATTCTTGAATCAAGTCCAGTCAGGTGGTCATTCTTTCTTAGGGAATTGAATTGGGTCAGCAGAGGTGGC