Transcript asmbl_216951

Sequence
Transcript Sequence for observation asmbl_216951 of TGE0006790:
CCAGCAGCAGCAGCAGCAGCAGCCCCCCACCCTTCCCGAATACGAGCACCACAGGGGCCCGGAAGCCCGCACAGGCGTTTAGAGAACATGGCAGACGATATTGATATTGAAGCAATGCTTGAGGCTCCTTACAAGAAGACTTGCCTAACGATATCTCACCTCTACTCCCATGAATTCACCTTTGATTCCAGTGTGAACTGTCAATCATAAGGGCGAGATGTGTGACAGAGGTGGCATCAAGCTCTTACAGTCCCAACCCTCCAACGGAAATGGGCGAAGATCTCAGGAATGGCATCGGTCACAGGAAATCGATAGTGGCTGGCTGCTAGCATGGCCACTTGGGGCTTAGGCAGAAATAGAGCCATGGTACTGACCAAAGGGACCATAGCACATGGAATAAAACTCAAAACAGGACTTCATTCATGTTTTAAAGAAATTCTATTTAACCACTTCAACACTAAATCTGGAATACTTAATATCTATATAAGAAAGTAAAATTTAACATGTTAATATGTATTTTTATTTTTGTATTTTGATGACTTAATTGTAAGCAACAAAGTGGTTAAACAACACATATCCATCTAAATTTTTTTATAGCCTTCCATGTTAAACTATAAATAAGTAATTAGTTTTAAAATTGTTTTGTATTTTCTTATTCCTGTTCCCTTTACCCTTTGACAACTTGAAATGTTACCACTTCGTCCTCATGATGTTCTTCTATCAACCCTGCTTAGGATGAGAACAAGTTGAGCAGTGCTAATGGCCATGAAGAACGTAGCAAAAAGAGGAAAAAAAGCAAGAGCAGAAGTCGTAGTCATGAACGAAAAAGAAGCAAAAGTAAGGAACGGAAGCGAAGCAGGGATAGAGAAAGGAAAAAGAGCAAAAGTCGTGAAAGGAAGCGAAGTAGAAGCAAAGAAAGGAGACGGAGCCGCTCAAGAAGTCGAGATCGCAGATTCAGAGGCCGCTACAGAAGTCCTTACTCCGGACCAAAATTTAACAGTGCCATCCGAGGAAAGATTGGGTTGCCTCATAGCATCAAATTAAGCAGACGACGCTCCCGAAGCAAAAGTCCATTCAGAAAAGACAAGAGTCCTGTGAGGGAACCAATTGATAATCTAACTCCTGAGGAAAGAGATGCAAGGACAGTTTTCTGCATGCAGCTGGCAGCAAGAATTCGGCCAAGGGATTTGGAAGAGTTTTTCTCTACAGTTGGGAAGGTTCGAGATGTAAGGATGATATCTGATAGAAATTCAAGACGTTCCAAGGGCATTGCTTATGTGGAGTTTGTCGATGTTAGCTCAGTGCCTCTAGCAATAGGATTAACTGGCCAACGTGTTTTAGGAGTGCCAATCATAGTACAGGCGTCACAGGCGGAAAAAAACAGAGCTGCAGCAATGGCAAACAATCTACAAAAGGGAAGTGCTGGACCTATGAGGCTTTATGTGGGCTCCTTACACTTTAACATAACTGAGGATATGCTTCGGGGGATCTTTGAACCTTTTGGCAGGATTGAAAGTATCCAGCTCATGATGGATAGTGAAACAGGTCGATCTAAGGGATATGGATTTATTACGTTTTCCGATTCAGAATGTGCCAAGAAGGCTTTGGAACAACTTAATGGATTTGAGCTGGCAGGAAGGCCGATGAAAGTTGGACATGTTACTGAACGTACTGATGCTTCCAGTGCTAGCTCATTTTTGGACAGTGATGAATTGGAAAGGACTGGAATTGACCTGGGAACAACTGGTCGTCTCCAATTAATGGCAAGACTGGCAGAGGGTACAGGTTTGCAGATCCCACCAGCAGCACAGCAAGCTCTACAGATGAGTGGCTCTTTGGCATTTGGTGCTGTGGCAGATTTGCAAACAAGACTTTCTCAACAGACTGAAGCTTCAGCTTTAGCTGCAGCTGCCTCTGTTCAACCTCTTGCAACACAGTGTTTTCAACTCTCTAACATGTTTAACCCTCAAACAGAAGAAGAAGTTGGATGGGATACAGAGATTAAAGATGATGTGATTGAAGAATGTAATAAACACGGAGGAGTTATTCATATTTATGTTGACAAAAATTCAGCTCAGGGCAACGTGTATGTGAAGTGCCCATCAATTGCTGCAGCCATTGCTGCTGTCAATGCATTACATGGCAGGTGGTTTGCTGGTAAAATGATAACAGCAGCATATGTACCTCTTCCAACTTATCACAACCTCTTTCCTGATTCTATGACAGCAACACAACTACTGGTTCCAAGTAGACGATGAAGGAAGATATAGTCCCTTATGTACATAGCTTTTTTTCTTTCTTGAGAATTCATCTTGAGTTATCTTTTATTTAGATAAAAATAAAGAGGCAAGGGTCTACTGTCATTTGTATACAATTCCTGTTATCTTGAAAAAATAAAAATGTTAACAGGAATGCAGTGTGCTCATTCTCCCTAACTAGCAATTCCCACTGTATACAAAGCTGTTCTCTAGTTCTGCCTTTTAAATGTACATGTAGAAAATTACATTAAGGATCTATAGAAATAGCTCTAGGGGAACAAATGTGCTTAATGTAAAAAGGCAGACAGGGATGTAATGATGTTTTTAATGTTTCAGAAGCCTAACTTTTTACACAGCAGTTACATTTCTCATTCACTAATGTTGATATTTGGCTAATGGTTTAGCAGAGGTTTCTGGAATACACTTTTAGTGAATGGAAATTGAAGACAGCTAAAGGGCTGTTGATTAACATCTCATCTTGCATTCTGGTCAATTGGCAAGAAAAGGAGATTTCAAAATTAACATTTCTGGATGGTATCTTTTCAATTAATGTATCTGTAAAAGTTTCTTTGTAAATATGTGTTCTAGTGTGTCTAAGATTCCAAACAAAATGATCCCTGCATTTCCTCAAGATGTTTAGTGACAGTCTGGTAAGGAAAGAAATAGGAAATGCAGAAATAGGTTTTGTCTGGTTGCATATCTTTGCTCTTTTTAAGCTCTGTGAGCTCTGAAATATATTTTTGGGTTACTTCAGTGTGTTTGACAAGACAGCTTGATATTTCTATCAAACAAATGACTTTCATATTGCAACAATCTTTGTAAGAACCACTCAAATAAAATTCTCTTAAAAAGGCCATAAGAAAATCTTCATTTTTGAAATGTTTTAAAGTCATAGAAACTTGAAAATAGAATACTAGTTTCTTTGACTCGGTATTTGCCTCTTTGGGAAAATTCTTAGCATGCAGAGTCTGGATATATTTGCCCTCAAGTTGTCCCTGTAAATTGCTCCATATCACTATATTATAGTACTATAGTTATCTTAGGACAATGGATCAAAACTGAGGGATTTACCAAAAAGAATTCACTCAGGCCTTAAACCTGGGTGTTCTTAAAGTCTCCTGTGTTATCTGGGCATCTTGGTGAAAAAAATAAAAATAAAAATGCTTTACTATTTAAATACTGAACAAAAAATGGTCTAAATTCAAACTGGTTTCCCAAATTTAATTGCATTTTACTTTATTATGGGACTTTGAGCTTTAACTTGGGTAGTGAGCCTTCACCATTTATACTCTGCACTCTGCTTCAAATTCTGTCTACGTTGAAACTTGGAGTAGGCAATGTTGCTCCTAAATGGAATGATCACCTTCAAATACTGGTTTCCTCACCTTGTTTCTATTGATAGCGCTGATGCATAAGTTTTATAGGTTTATTCAGATAAGATATTTAATCAATTTGAGTATGGTGGCATCAGTTTTCCACCAACCATTTTGACATATTTAATCCAAAATTCCTTGCTTCAGTTAACTTGAACATTTTTAAAATTAAAAATGATTTTTCAACATTGGGCAGCAGTTTCTTGGAGCTGACTTATCCTGACAGTGTTTTCTTTCCAAAGTATCTCCATAATTAAACTTTTAATTCTTGAATCAAGTCCAGTCAGGTGGTCATTCTTTCTTAGGGAATTGAATTGGGTCAGCAGAGGTGGC