Transcript asmbl_216941

Sequence
Transcript Sequence for observation asmbl_216941 of TGE0006784:
TCTCTCGCCCCAAACCGGCAATTTCCGGGAGATTGCCCGAAAACCTCAGTGCGCTTGCGCCGTCCCGCCCGTGACGTAAACCACTTCATCCCGCCCCTTCTGGAACCCAGAGCTGCAGAGCGGGCCGGCGGCCATTTTGTGAAGCGGCGGAGGAGGTGGTGGCTGCTGTGGGCTCCGGGAAGCTGTTCGCGCAGGGGCTGTCGGCCGCGGGGCGAAGGCACTCGCGCGGGGGGTAACTCGGGTCTGGGTTCAGGTGCCGCGCAGCTCTCCCCGTCTAAAAGTTGGTTTTAATTGGTTGCCCACAGGATTGACTTGGCCTCTACTTCTTGTTAAGAAAATACATCTCTTGTTTTATCAGATGGCCCGCTGCGTGACCTTGGTTCAACTGTCCATTTCCTGTGACCACCTCATCGATAAGGACATCGGCTCCAAGTCTGACCCACTCTGTGTCCTTTTACAGGATGTGGGAGGGGGCAACTGGGTTGAGCTTGGCCGAACTGAGCGAGTACGGAACTGCTCGAGCCCTGAGTTCTCCAAGACTCTGCAGCTTGAATATCACTTTGAAACAGTCCAGAAGCTCCGATTTGGCATCTATGACATAGACAACAAGACACCTGAGCTGGGGGATGACGACTTCTTAGGTGGGGCTGAGTGTTCCCTAGGACAGATTGTGTCCAGCCAGATAATAACTCTGCCTTTGATGCTGAAGCCTGGAAAACCTGCTGGGCAGGGGACCATCACGATCTCATCTCAGGAATTGAAGGATAGTCGTGTAGTGACCATGGAGGTGGAAGCCAGAAACCTAGATAAAAAGGACTTCCTGGGGAAATCTGATCCATTCTTGGAGTTCTTCCGCCAGGGTGATGGGAAATGGCACCTGGCATACAGATCTGAGGTAATCAAGAACAACCTGAACCCTGCATGGAAGCGCTTCTCTGTTCCCCTTCAGCATTTCTGTGGGGGAGACCCTAGCACACCTATCCAGGTACGATGCTCAGACTATGACAGTGATGGTTCACATGATCTCATTGGTACCTTCCACACCAGTTTGGCCCAGCTGCAAGCAGCCCCAGCTGAGTTTGAATGCATCCACCCTGAGAAACAGCAGAAAAAGAAAAGCTACAAGAACTCTGGAACTATTCGTGTCAAGATTTGCCAGGTAGAAACAGAGTATTCATTCCTCGACTATGTGATGGGAGGCTGTCAAGTCAACTTTACTGTGGGTGTGGACTTCACAGGCTCCAATGGAGACCCCTCCTCACCAGACTCCCTGCACTACCTGAGCCCAACAGGGGTCAACGAGTACCTGACAGCACTGTGGAGTGTGGGAAGCGTGATTCAGGACTATGATTCGGACAAGCTGTTCCCAGCATTTGGATTTGGGGCTCAAGTGCCCCCTGACTGGCAGGTCTCCCATGAATTTGCTTTGAACTTCAATCCCAGTAACCCCTACTGTTCAGGCATCCAGGGTATTGTGGATGCCTACCGTCAGGCCCTGCCCCAAGTTCGCCTCTATGGCCCCACAAATTTCGCACCCATCATCAACCATGTGGCCAGGTTTGCAGCCCAGGCTGCACAACAGAGGACTGCCTCGCAATACTTTGTGCTGCTGCTGCTAACCGACGGTGCTGTGACAGATGTGGAGGCCACACGTGAGGCTGTGGTTCGTGCCTCCCACCTGCCTATGTCAGTGATCATCGTGGGTGTGGGCGGTGCTGACTTCGAGGCCATGGAGCAGTTGGATGCTGATGGTGGACCCCTGCGCACACGCTCCGGGGAGGGAGCTGCCCGTGACATAGTGCAGTTTGTGCCCTACCGCCGCTTCCAGAATGCCCCTCGAGAGGCATTGGCGCAGACTGTGCTCGCAGAGGTACCCATGCAACTGGTCTCCTACTTCAAGGCCCAAGGCTGGGCCCCATTCAAGCCGCTTCCACTCCCAGCCAAGGGCCCTGCAGAGGCTCCTCAGGCCTAGATTCCCTTGGAGCGTAGGTTATGGCCAGTCCTCAGCCCTGTGTCCCCACCTCTGAACACACTTGCCAGTGCTAGCAGTTTATATATTTTATACTTTTATACTTGCTCCTGCTATTGCTGCTCTTGATCCCACCTGCTTGCCCCCTGGAGCCCTTCATTCAATAAAGATCAACGATGACCA