Transcript asmbl_216402

Sequence
Transcript Sequence for observation asmbl_216402 of TGE0006647:
GTGAGTTGCTGCGTGCGAGGGGGGCGACGTAAGGGCGCTCCGCGAGCCCGTCTCCTCGAATGAAAGGAAACAACCTCCGGCGACAGAGCCCCGCTCTCAGGCGCTGCCGGAGAACCGAGACCGACTTCTTTCTCTTAACCCTCATTGGCGCTTCTCCTCTGCCGTTCGCCTCTGGGCCCCGCCGCATTTCTTGAGGCCTAAAGTGGCATTCTAAAGGCAATTTAAAAATCATGTCAAGCTCAGTTGAACAGAAAAAAGGGCCTACAAGACAGCGCAAATGTGGCTTTTGTAAGTCAAATAGAGACAAGGAATGTGGACAGTTACTAATATCTGAAAACCAGAAGGTGGCAGCACACCATAAGTGCATGCTCTTTTCATCTGCTTTGGTATCATCACACTCTGATAACGAAAGTCTTGGTGGATTTTCTATTGAAGATGTCCAAAAGGAAATTAAAAGAGGCATGAAGCTGATGTGTTCTTTGTGTCATTGTCCTGGAGCAACAATTGGTTGTGATGTGAAAACCTGTCACAGGACATACCACTACCACTGTGCATTGCACGATAAAGCTCAAATACGAGAGAAACCTTCACAAGGAATTTACATGGTTTATTGCCGGAAACACAAGAAAACTGCACATAACTCTGAAGCTGATTTAGAAGAAAGTTTTAATGAACATGAACTGGAGCCCTCATCACCTAAAAGTAAAAAGAAAAGTCGCAAAGGAAGACCACGAAAAACTAATTTTAAAGGGCTGTCGGAAGATACCAGGTCCACATCCTCCCATGGAACAGATGAAATGGAAAGTAGTTCCTATAGAGATAGGTCTCCACACAGAAGCAGCCCTAGTGACACCAGGCCTAAATGTGGATTTTGCCATGTAGGAGAGGAAGAAAATGAAGCAAGAGGAAAACTGCATATATTTAATGCCAAGAAGGCAGCTGCACATTATAAGTGCATGTTATTTTCTTCTGGCACAGTCCAGCTCACAACAACATCAAGAGCAGAATTTGGAGATTTTGATATTAAAACTGTACTTCAGGAGATTAAGCGGGGGAAAAGAATGAAATGTACACTTTGCAGTCAGCCCGGTGCTACTATTGGATGTGAAATAAAAGCCTGTGTTAAGACTTACCATTACCACTGTGGAGTACAAGACAAAGCTAAATACATTGAAAATATGTCACGAGGAATTTACAAACTGTATTGTAAAAATCATAGTGGAAATGATGAGAGAGATGAAGAAGATGAGGAACGAGAGAGTAAAAGCCGGGGAAAATTAGAAATTGATCAGCAACAACTAACTCAGCAGCAACTTAATGGAAACTAGGTATGAAAGTTAATTATATCGGATCTGTTGTCAGAATACAATACACATTGATAAAAACATGTTGAAATAATGGTGTGCAGTATGATTTTTTAATGCTATTGTGTTTAGTTAAGCATGTTATTAGAATACTGAGGATTGTGTAGGCTTGCATAGTTTTTTAAACTAGCTGATTTTGTAACAATAAAAACAAGCTATCCAATTTATCAATAAATGTAGTTGTAATGTCAAATCAGTAAGATATTCTCGCTCCCCAATAACATTATATTTATTGTGTTCCCCTCAAGCATCATATTTTACATTTTTTTATCATCTTTTAAACAGGTTCATGGGACAGAGTTAGAAAACTGGGAATGAATAAGACATCCATAACTACTATTCTTTTTTCACTGTTTTCTAAAATCAAAAAGGGTTTGTAACTTTTTACTGCCCAACTCTTAGATCCTTCATTGAACTGCCTAAAAACGTCTTGTTTTATGAGCCTTCTTCACTAGATGGCAGAGTTTGACATGTTGATATTACGTAGCTGTAGTTTGCAGTTTCTGGGAAGCGATTGAAACACTATTAACCCTGTGTATAGTGTCAACAGTTAAAGCAGACATTGAAATGAAGTAAGCTATATTTCTGGACCGAACAAAGTTCTGCTGTTTAGAGTGTCTAAGTTTGCTTAGTGGATTCATACTCAAAGGAAAGTATAAGCAAATTTCACTTAACAGTGCAAACATGCCTCTGGTGGCAACATGTGGGAATTTGTGGAATTTTTTTTCACACGCAAGTAATGGAGGCTAGAAATGAAGAGAACTTTATTTTTCCCTTGGCTTTGACAGCAAATGCTTAAAATCTCTTCCAAGAAGTGTGCTAAGCTTTTCATTTGGTTCCTGTTAAAGTTGTTCTCACTGACCAGCATGGACTTGGGCAACTGGTGATTATAAGCTATGAGCTCCAGTGCTTATGCCAAAATTATCTTGACAGTAAACCTCTTTTCTTTTCATGTCATACAAAGAGCTTCTAGCAAAATGATTGGATCCTTTCGAGTTTAAACTAACATTTGGCGACAGCAAATTAAACCTCTTTAAGACTCACTAAGGACTTTAGCCACCATGTCTGAAACCTGTTCCTCTCAAGTGCCGTGTTGTGTGGAACACTTCTTATATTGGCCCAAAGTATGTAAGGAGGTCTCATGTGCTCTAGGAGTAAAAAAACAGTCTTCGCATAAAACAGTATTTATTTTTAATTTTGTGACCACTATTTTAGAAACTTTATTTAATGTTTTTAATGTTTCATTCAGTGCTTTGCTTATCTAGTAAATAGGCTTTTGTGCCCTACTTTTCCTCTGGTAGGGCTTGCTGTTGTACTATTGATCATCAGAATTGTTTCTCAAAGCCTAAGAACCCAGCATTTTAGAAAGGATTTTCACACTGGCATTTCTAGCTAGTGTTATTTTCTTCCACTTACTTGCTGAAGCACATTTATATATTTCTTCATGGCAAAACCAAAAAACTTTAGTTGTGGTCTGCCTAATATTACCATAGCACCTCATTTATCAAGGGTAGGGATTCTGATCATTGAATTATTAGTTAATTAAATTAAATCAGCAGGCAAATAATCATGTTAACTTGACTGCACATCAAGATATTCTACAGCTTATGGAAAAGCATTTTAAAAATGTAACAGGTGGAAAATTACACTGTGCTTAATGACTGATTTTTTTTTAACTGCTAGTCCCTTAAAGTCATATTTGTCAAGTGTGTATTCACACATTTACTTAAATCAAGGGACTCGATTGCTTTATTTTAATCATCTTTTATTATTTTTAGAAGGAAACTAGCTTTAGTAGTGAGTTGTCTTCCCTATATGTTTTTCTCTTCTTGCTCTAAATATGCCATTGGGTTTCTTTGTGTGTATGTGATGAATTTTCAAAATTCACCGTGACTTGAAGTGCAACGACAGATCTAGATGTTTGTTTACCAAGCTATGTGACTTTTCCCAAAGGATCTGTACTTTATTTCCTTACAACAGCTTGAAACCCGTTATTTTAAATCTTTGAATCACTGTGTCTAGATCATTTTTACATTGTGTGCCATTGATTTACCCGTGGAACTATAGAGCACCTTCATTTTTGGACAACTACTGTAATGATGTTTTTAGGAAAAATAGAAGGTGCCAGGGGTAATAATGGCCAGTCAATAATCACATAATGGACTTCAAATACTATAGCTGTCAGTTGATGGATTTGTTATGTAATAAAGTGTATGATTTTTGTATGGGTTTCTTCAACCCTTTCTGCCACTAGCAACCAGAATAGCACTTTTACCTTTTGGTTGGCTAGGTAAGTGGCTGGCTACCTATTTTTCTCACTGTGGTGTGATTGGCTAAATAGTCTTTCATTAAAAATTAAAATGTAAATTGAAGTCACACGAAAAATCATGTTTGGTTGTAAACCGCCGATATTTTGTTTTTCTATCTATGTTTTCGTCACATGCTGAGTAAAAGTGCCTTACAATGTAAAAATTGTACAGTACTTATGTTCTCAAGTAGCATCATCATCTTCTGGGTAGTAATTACATTGTGGTATGAATATTTAGAAAAATGGACCTCAGCAGTGTATTTACTGTTCATCTCTTAAGTCCTTAACTGTAGTTTTAATAAGCATGACATTATTTGATAAGTATATAACATTTACATCATTTCAAAAAATACTGCCATGACTGTCTTTTATGCATATTTTAGCTTGAAATTTTGAAGCATCTTTACTGTTTTCCTTTTTTCTTTTTTCCTTT