Transcript asmbl_216050

Sequence
Transcript Sequence for observation asmbl_216050 of TGE0006642:
TGGCGCACGTCGGTAGTCAGCTGCCGCGGCCTGGGGCTGGGATGTGACGGACTGCTGGTCCCGTCAGTGGCGTCTTCCCTGAGCGGCGGTGACTGCGGCGAGGGCGGCGTGGACAAGGCCAGCGGGCGCCATTGGCGACCGGCCGTGTCGGCCGCGGGATGAGGAAGCGGACCGAGCCCGTCGCCTTGGAGCATGAGCCCTGCGCCGTCTCGGGCTCGACTTCCTCCGGCTCGGCCGCCGCGGTGCTGGACACCGACTGCAGCCTGAAGCGGAAACTGTGCCTGGCGGGCAGGGGACCGGGCGAGACGCGCAGCGCCGCGGACGCGGACATGAAGCGGGCGCTAGGCAGGCGAAAGGGCCTGTGGTTCCGACTGAGGAAGATACTTCTCTATGTTTTGGGGTTATACATTGCCATTCCATTTCTCATCAAACTATGTCCTGGGATACAGGCCAAACTGATTTTCTTGAATTTTGTGAGGGTTCCCTATTTCATTGACTTGAAAAAACCACAGGATCAAGGTTTGAATCACACCTGCAATTACTACCTCCAGCCAGAGGAAGATATAACCATTGGAGTCTGGCACACTGTCCCCACTGTCTGGTGGAAGACTGCCCAAGGGAAGGACCAGATGTGGTACGAGGATGCCTTGGCTTCCAGTTACCCTATCATCCTGTACCTGCATGGGAATGCAGGTACCAGAGGAGGTGACCACCGAGTGGAACTTTACAAGGTGCTGAGTTCCCTTGGTTACCACGTGGTCACTTTTGACTATAGAGGTTGGGGTGACTCAATAGGCACGCCATCAGAGCGGGGCATGACCTATGATGCACTCCATGTTTTTGACTGGATTAAAGCGAGAAGTGGAGACAACCCCGTGTATATTTGGGGCCACTCCCTAGGCACTGGAGTGGCAACAAATCTGGTGCGGCGCCTCTGTGAGCGAGAGACACCTCCAGATGCCCTAATATTGGAATCTCCATTCACCAATATTCGTGAAGAAGCTAAGAGCCATCCGTTCTCAGTGATATATCGATATTTCCCTGGATTTGACTGGTTCTTCCTTGATCCCATTACAAGCAGTGGAATTAAATTTGCAAATGATGAAAATGTGAAGCACATCTCCTGCTCCCTGCTCATCTTGCACGCTGAGGATGACCCAGTTGTGCCCTTCCAGCTTGGCAGAAAGCTCTACAACATTGCTGCACCCTCTCAGAGCTTCCGAGACTTCAAAGTTCAGTTTATCCCCTTTCACTCAGACCTCGGCTACAGGCACAAGTACATCTACAAGAGCCCTGAGCTTCCTCGAATACTAAGGGAATTCCTGGGGAATTCGGAACCTGAGCACCAGCACTGAGCTCACTGCTTGAAGGAGCATGAAGACCTTTGCCCTCCTCCCCATTCCTCCAGCCAACCCAGCACCGTGGAGCAAGGGTACCAGCGTCTGTGATGCACCTGGAGAGAGGACTCGGATGCCATCTAGGGCAGGAAGAGGAGGCCACAGCAGACTGGTGGCCAGGAGCATAGATCTTTGTGGAAAATGCGAGTGGCAGGCATGTGGCCCTCTCTCCCTCTTGCTGCCACTCAACCTGAGTTCTTGGAAGGACAGTGACACAGCAGGCAGCAACCAGCAGGTCGATCCCACACTTCTTGAGCTGGGTATGGAGAATGAGGCAGGAAGTATGAAGTCTTGGGACCACACTGAGCTATCCGGTACCACCCATGAGAATGTGAGGACACTTGGGTTCTTCTGTCCCTTCCCAGCACATGCAGAATGGACTCTGTTGGTTCCATAGCCCCTTCCTGCCCTCTGCACCCCCACTTGCCTTCCTTGGTGTCCCTGCCTCCCTTGGCAGGCCCACCACTCACAGAGAGGGAAGTGCCCACGATCTGCACTTCCTCCACTTTCCACCCACCTGTTCACCTGAGCGTTTATTTAATAAAATCCTAGTGGTGGTCTGTC