Transcript asmbl_21485

Sequence
Transcript Sequence for observation asmbl_21485 of TGE0007115:
CCTGCTTCCGGCGCGTTGGAGGTAGGCTGGGTGTTCTGCGAAGGGGTAGATCCGGTTCAGTGAGAGAATGATAAACGACTGAGAGAAGGATCAAGGAAACAACTGAGGAGAATTTAGGGGCAGGTTATGCGACGTGGAAATGGGGGCATAGGTTTCTGGGGAGGGCACACACGGAGTGGCGTCTTGCATCTCTCGGTAGATTCCAGAATCCTCCGCTATTCAGGACCGTGCAGGAAGACCATGCCGAGACCCAAGAAGAGGATGGCTGGGGCTGCTGAGCCAGACAAGAAGGGACCAGCAGGAAAACGTCCCAAGATTAAGAACCTAGGTGAGACATCAACTAAAGTGGAGAACTCCAGCCCTCAGAAGACTTCAACCTCTAAAAATTGCACGAAAAATCTAAGCAGCTATTGGCTGATGAAGTCAGAGCCAGAAAGCCGTCTAGAGAAAGGTGTAGATGTGAAGTTCAGCATTGAGGATCTCAAAGCACAGCCCAAGCAGACAGCATGCTGGGATGGTGTCCGCAACTATCAGGCTCGGAACTTCCTTAGAGCCATGAAGCTGGAGGAAGAAGCTTTCTTCTACCATAGCAACTGCAAAGAGCCAGGCATTGCCGGACTTATTAAGATTGTGAAGGAGGCTTACCCAGACCACACACAGTTTGAGAAAAGCAATCCCTATTATGATCCCTCCAGCAAAGAAGACAACCCCAAATGGGCCATGGTGGATGTACAGTTTGTTCGGATGATGAAGCGTTTCATTTCCTTGGCGGAGCTCAAAACCCATCACCAAGCTCACAAAGCCACTGGTGGCCCCTTAAAAAATATGGCACTCTTCACTCGCCAGAGACTCTCAATTCAGCCCCTGACCCAAGAAGAATTTGATTTTATTTTGAGCCTGGAGGAAAAGGAACCAAGTTAACTGATACGCTGGAATGGGCAAGACATTATTCCAAAGGAGTGAAGCTTTTATAAGACAAAAGGTGTGAGGAGGCTTGCTTGTTATGTTCATTGGGGTTTGTGTACATAGGTGGGTTTTGTGTACTTTCTCAATAAAATGCTAATATCAA