Transcript asmbl_210647

Sequence
Transcript Sequence for observation asmbl_210647 of TGE0006626:
CGGAAGTGGCCGGGAGGCAAAGGCCGAGCCCCTTCGGTCATCTCCGGCGCTTCAAGGGGCGTTTCCTGTACTCTTCGGTGCCGTGGAGGTACTAATTTAAGAGATGCCCCTTTTATTAATTTATTTTCAAACCCAAAAAAAAGCCACGGATGATTTATGGGCCATTTAATTCAGAGCCCTGGTTTTTACGTTGAAGAGTGAGATTAACATACTTTGACCTTTAACCTTCGGCACGGTGCGGCGGAGGGAAACGCCTCCGTCTCTATATAAGGAATTTCCCGGACTCTTGCGGCCTCTTTTTTTCCTCTTAACGTTCAGCGAGAACTGCAAACGATCCTGTTTCCTCCGCTGCTGCCCAGTTGCCGGACCAGCAAACGCCATGGGTTTTGGAGACCTGAAAAGCCCCGCTGGCCTCCAGGTGCTCAACGACTACCTGGCGGACAAGAGCTACATCGAGGGGTATGTACCATCACAAGCAGATGTAGCAGTATTTGAAGCAGTCTCTGGCCCACCACCTGCCGACTTGTACCATGCCCTACGTTGGTATAATCACATCAAGTCTTACGAAAAGGAAAAGGCCAGCCTGCCTGGAGTGAAGAAAGCTTTGGGCAAATATGGCCCTGCTAATGTGGAAGACACCACTGGAAGTGGAGCTACAGATAGTAAAGATGATGATGACATTGATCTCTTTGGATCTGATGATGAAGAGGAGAGCGAAGAAGCAAAGAGGCTAAGAGAAGAGCGCCTTGCACAGTATGAGTCAAAGAAAGCCAAAAAGCCTGCACTTGTTGCCAAGTCTTCCATCTTATTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCTAAATTGGAGGAGTGCGTCAGGAGCATTCAAGCAGATGGCTTGGTCTGGGGCTCTTCTAAACTAGTTCCAGTGGGGTATGGAATTAAAAAACTTCAGATACAGTGTGTAGTAGAAGACGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGACGTGGCTGCTTTCAACAAGATCTGAAATCCATCATGGATCATTACTCTTAAATAAAAGCTTG