Transcript asmbl_210646

Sequence
Transcript Sequence for observation asmbl_210646 of TGE0006626:
CGGAAGTGGCCGGGAGGCAAAGGCCGAGCCCCTTCGGTCATCTCCGGCGCTTCAAGGGGCGTTTCCTGTACTCTTCGGTGCCGTGGAGGTACTAATTTAAGAGATGCCCCTTTTATTAATTTATTTTCAAACCCAAAAAAAAGCCACGGATGATTTATGGGCCATTTAATTCAGAGCCCTGGTTTTTACGTTGAAGAGTGAGATTAACATACTTTGACCTTTAACCTTCGGCACGGTGCGGCGGAGGGAAACGCCTCCGTCTCTATATAAGGAATTTCCCGGACTCTTGCGGCCTCTTTTTTTCCTCTTAACGTTCAGCGAGAACTGCAAACGATCCTGTTTCCTCCGCTGCTGCCCAGTTGCCGGACCAGCAAACGCCATGGGTTTTGGAGACCTGAAAAGCCCCGCTGGCCTCCAGGTGCTCAACGACTACCTGGCGGACAAGAGCTACATCGAGGGGTATGTACCATCACAAGCAGATGTAGCAGTATTTGAAGCAGTCTCTGGCCCACCACCTGCCGACTTGTACCATGCCCTACGTTGGTATAATCACATCAAGTCTTACGAAAAGGAAAAGGCCAGCCTGCCTGGAGTGAAGAAAGCTTTGGGCAAATATGGCCCTGCTAATGTGGAAGACACCACTGGAAGTGGAGCTACAGATAGTAAAGATGATGATGACATTGATCTCTTTGGATCTGATGATGAAGAGGAGAGCGAAGAAGCAAAGAGGCTAAGAGAAGAGCGCCTTGCACAGTATGAGTCAAAGAAAGCCAAAAAGCCTGCACTTGTTGCCAAGTCTTCCATCTTATTAGATGTGAAACCTTGGGATGATGAGACAGATATGGCTAAATTGGAGGAGTGCGTCAGGAGCATTCAAGCAGATGGCTTGGTCTGGGGCTCTTCTAAACTAGTTCCAGTGGGGTATGGAATTAAAAAACTTCAGATACAGTGTGTAGTAGAAGACGATAAAGTTGGAACAGATATGCTGGAGGAGCAGATCACTGCTTTTGAGGACTATGTGCAGTCCATGGACGTGGCTGCTTTCAACAAGATCTGAAATCCATCATGGATCATTACTCTTAAATAAAAGCTTG