Transcript asmbl_210421

Sequence
Transcript Sequence for observation asmbl_210421 of TGE0006608:
CACGTGGGTGGGCGGTGCCCCGGGGTGCGGTTACAGACTACCGCTCTTTGGTCACCTGGGCTTCTAGTTCCAGTTCGATTCCTTCTGCTGAGCTTTGCCGAAGGAATCTTATTAATGGACGCGTGAATCGTGCGACATTTAATTAACCAGGTGATGGCAGCCATCGAGATATTGGCCTTAATAAGAAGCCAGGAGTTCGCACGATTTCCCCCGCCTTCATCTTAGGAAAGTGATCAGGATCTGAACCAATGATGCTGGGTTCACCCACATCTCCAAAGCCAGGGGTTAATGCCCAGTTCCTACCTGGATTTTTAATGGGGGATTTGCCAGCTCCAGTGACTCCACAACCTCGAACAATTAGTGGCCCTTCAGTAGGAGTAATGGAAATGAGATCACCTTTGCTTGCAGGTGGGTCACCACCACAACCAGTTGTACCAGCTCATAAAGACAAAAGCGGAGCTCCACCAGTTAGAAGTATATATGATGACATTTCCAGTCCAGGACTTGGATCAACACCTTTAACTTCAAGAAGACAGCCAAACATGTCATTAATGCAGAGTCCTCTTGTTGGAGTTACGACAACTACTCCTGGGATAGGGCAAAGTATGTTTAGTCCAGCAAACATTGGACAACCACGAAAGACAACGTTATCTCCTGCCCAGTTGGATCCTTTTTATACTCAAGGAGATTCTCTGACTTCTGAAGATCACCTCGATGACACATGGGTGACTGTGTTTGGGTTTCCTCAAGCATCTGCTTCCTATATATTATTACAATTTGCACAATATGGGAATATCTTAAAACATGTGATGTCTAACACAGGAAATTGGATGCATATTCGTTATCAATCTAAACTGCAGGCTCGGAAGGCCTTAAGCAAAGATGGGAGGATTTTTGGAGAGTCCATCATGATTGGTGTAAAACCATGTATAGATAAAAGTGTTATGGAAAACAGTGACAGGTGTGCTTTGTCATCCTCACCTCTGGCCTTTACACCACCAATCAAAACCCTAGGTACACCAACCCAATCTGGAAGTACTCCTAGGATTTCTACCATGAGACCTCTTGCTACAGCATACAAAGCTTCTACTAGTGACTATCAGGTCATTTCTGACAGACAAACGCCGAAAAAAGATGAAAGTCTTGTATCCAAAGCAATGGAGTACATGTTCGGCTGGTAGTGTAATAACAGCTAAGAACTGAACTACAAAGGAGGAGGCTGCTACACTAAAACAGTTAGCAGAGTACTGCCAGGTTTCCTTGGGTTAATTATATAACCACTCTCGGCAGTATTGGATAGCTATCTTATACTTTCTTTAGAAGCCTTTTTCTTTAAGGATACAACATATTTGTAGCTCGCACTTTAAAAGATGATTGAGATATGTTTTAAAGAAACAAAAACTCCCTGTAAACAGGATTTTGTGCTTTCTGTAGTAGTGCATGCTTAAGCACAAAAAAACTCAGCATTGATTACTATAAAGTATATAATTGAGTTTGAGATGAAGCTTTGTAGTCTTCTTGAGTTGGTAAGGAGAATTTCATGAAGGGTAACTGTACAGCTGCTTCTAACAAAACACAGTTTATAATTAACAATTTGAATTATGGCCTTTTAATTTAGATAGTATTTAATATTTTAATTATCCTTGTTTTTATATGTCCTATCATGGACTGTCATCTTTCAGTATTCTTAAAAAGCCAGAACAGTCTTTTTAAAAACCTACTAAAGTTCTTGATAATAAACTTATATGTATTGAATGTTTTTTGAAAGAGTGCTTTTTTTTATTATCACAAAAAGTTATAAAAATGCTTTCTGAAGTAGAGAAAATATGTCATCAACCTCCATATACCTGTAATCCAGCTCTAATAACCATCCATATTTTGTCATATCTGTTTCTTTTTCTCTTTTGTTTAATGACATCAAATGTGATGTCATTTTAATCTGAATATTTGAGGACATGGCAAAAAAGAACATTTCCAAAGGTAATTACAATGTCAGAATCACACCTAACAATTAATAATAATTTCTTAATATCTAATATCGAGTCCATTAAAAAATTTCTCAGTTGTCTCAAATGTATTTACAGTTGGTTTATTTGAATCA