Transcript asmbl_210420

Sequence
Transcript Sequence for observation asmbl_210420 of TGE0006607:
CGTGGGGAGAGTTTCCGCCATTTTTGAAAATTGAGAAAGTCCGGAGCTAGGAGTAATTGCAGCCGCGATGGCAGCCTTTGCTGTGGAACCCCAGGCGCCCACGCTGGGATCTGAACCAATGATGCTGGGTTCACCCACATCTCCAAAGCCAGGGGTTAATGCCCAGTTCCTACCTGGATTTTTAATGGGGGATTTGCCAGCTCCAGTGACTCCACAACCTCGAACAATTAGTGGCCCTTCAGTAGGAGTAATGGAAATGAGATCACCTTTGCTTGCAGGTGGGTCACCACCACAACCAGTTGTACCAGCTCATAAAGACAAAAGCGGAGCTCCACCAGTTAGAAGTATATATGATGACATTTCCAGTCCAGGACTTGGATCAACACCTTTAACTTCAAGAAGACAGCCAAACATGTCATTAATGCAGAGTCCTCTTGTTGGAGTTACGACAACTACTCCTGGGATAGGGCAAAGTATGTTTAGTCCAGCAAACATTGGACAACCACGAAAGACAACGTTATCTCCTGCCCAGTTGGATCCTTTTTATACTCAAGGAGATTCTCTGACTTCTGAAGATCACCTCGATGACACATGGGTGACTGTGTTTGGGTTTCCTCAAGCATCTGCTTCCTATATATTATTACAATTTGCACAATATGGGAATATCTTAAAACATGTGATGTCTAACACAGGAAATTGGATGCATATTCGTTATCAATCTAAACTGCAGGCTCGGAAGGCCTTAAGCAAAGATGGGAGGATTTTTGGAGAGTCCATCATGATTGGTGTAAAACCATGTATAGATAAAAGTGTTATGGAAAACAGTGACAGGTGTGCTTTGTCATCCTCACCTCTGGCCTTTACACCACCAATCAAAACCCTAGGTACACCAACCCAATCTGGAAGTACTCCTAGGATTTCTACCATGAGACCTCTTGCTACAGCATACAAAGCTTCTACTAGTGACTATCAGGTCATTTCTGACAGACAAACGCCGAAAAAAGATGAAAGTCTTGTATCCAAAGCAATGGAGTACATGTTCGGCTGGTAGTGTAATAACAGCTAAGAACTGAACTACAAAGGAGGAGGCTGCTACACTAAAACAGTTAGCAGAGTACTGCCAGGTTTCCTTGGGTTAATTATATAACCACTCTCGGCAGTATTGGATAGCTATCTTATACTTTCTTTAGAAGCCTTTTTCTTTAAGGATACAACATATTTGTAGCTCGCACTTTAAAAGATGATTGAGATATGTTTTAAAGAAACAAAAACTCCCTGTAAACAGGATTTTGTGCTTTCTGTAGTAGTGCATGCTTAAGCACAAAAAAACTCAGCATTGATTACTATAAAGTATATAATTGAGTTTGAGATGAAGCTTTGTAGTCTTCTTGAGTTGGTAAGGAGAATTTCATGAAGGGTAACTGTACAGCTGCTTCTAACAAAACACAGTTTATAATTAACAATTTGAATTATGGCCTTTTAATTTAGATAGTATTTAATATTTTAATTATCCTTGTTTTTATATGTCCTATCATGGACTGTCATCTTTCAGTATTCTTAAAAAGCCAGAACAGTCTTTTTAAAAACCTACTAAAGTTCTTGATAATAAACTTATATGTATTGAATGTTTTTTGAAAGAGTGCTTTTTTTTATTATCACAAAAAGTTATAAAAATGCTTTCTGAAGTAGAGAAAATATGTCATCAACCTCCATATACCTGTAATCCAGCTCTAATAACCATCCATATTTTGTCATATCTGTTTCTTTTTCTCTTTTGTTTAATGACATCAAATGTGATGTCATTTTAATCTGAATATTTGAGGACATGGCAAAAAAGAACATTTCCAAAGGTAATTACAATGTCAGAATCACACCTAACAATTAATAATAATTTCTTAATATCTAATATCGAGTCCATTAAAAAATTTCTCAGTTGTCTCAAATGTATTTACAGTTGGTTTATTTGAATCA