Transcript asmbl_210347

Sequence
Transcript Sequence for observation asmbl_210347 of TGE0006588:
TAAACTCTCGCCGTAGCAGCCGCCGCCCATCCCTCTTTGTGTGTTTCGGGAAGCCGCAGAGCTAGTGGCGGTGACTCTTGGCATTGGGGGTGAAGGAAAGGGACGTTACAGGGAACTTGCAGGCGGCAGGACTCTTCTCCATCCCGCCACTTGACAGGTCACAAACATGTCAGACAAAAGTGAATTAAAGGCAGAGTTGGAACGGAAGAAGCAGCGGTTGGCCCAAATCAGAGAGGAAAAGAAGAGAAAAGAAGAAGAAAGGAAAAAAAAGGAAACTGATCAGAAGAAAGAAGCAGTTGCTCCTGTACAAGAAGAATCAGATCTCGAAAAAAAAAGAAGAGAAGCTGAAGCACTGCTTCAAAGCATGGGGCTAACTCCAGAATCCCCCATTGTCCCTCCTCCTATGTCTCCATCCTCCAAATCTGTGAGCACACCAAGTGAAGCTGGGAGCCAAGACTCTGGAGATGGCGCAGTGGGATCTAGACGAGGACCTATTAAACTTGGAATGGCTAAAATTACACAAGTTGACTTTCCTCCTCGAGAAATCGTGACATATACAAAGGAAACTCAGACTCCAGTTATGGCTCAACCCAAAGAAGATGAAGAAGAAGAAGATGATGTGGTGACTACTAAACCACCTATTGAACCTGAAGAAGAGAAGACTTTAAAGAAAGATGAGGAAAATGACAGTAAAGCTCCCCCTCATGAGCTGACTGAAGAAGAAAAGCAACAAATCTTGCACTCTGAAGAATTTTTAAGTTTCTTTGACCATTCTACACGAATTGTAGAAAGGGCTCTTTCTGAGCAGATAAACATCTTCTTTGACTACAGTGGGAGAGATTTGGAAGACAAAGAAGGAGAGATTCAAGCAGGTGCTAAACTGTCATTAAATCGACAATTTTTTGATGAACGTTGGTCAAAGCATCGGGTTGTTAGTTGTTTGGATTGGTCATCTCAGTATCCAGAGTTACTCGTGGCTTCATATAATAACAATGAAGATGCTCCTCATGAGCCTGATGGTGTGGCCCTTGTATGGAATATGAAATATAAAAAAACTACCCCGGAGTATGTGTTTCACTGCCAGTCAGCTGTGATGTCTGCTACATTTGCAAAATTTCATCCAAATTTGGTTGTCGGTGGTACATACTCAGGCCAAATTGTGCTGTGGGATAACCGTAGCAATAAAAGAACTCCAGTGCAAAGAACTCCACTGTCAGCTGCTGCACACACACATCCTGTATATTGTGTAAATGTTGTTGGAACGCAAAATGCTCATAATCTGATTAGCATCTCTACTGATGGAAAAATTTGTTCATGGAGTCTGGACATGCTTTCCCATCCACAGGATAGCATGGAATTGGTTCATAAACAGTCAAAGGCAGTAGCTGTGACATCTATGTCCTTCCCTGTTGGAGATGTCAACAACTTTGTTGTTGGGAGTGAAGAAGGTTCTGTGTACACAGCATGTCGCCATGGCAGCAAAGCTGGAATCAGTGAGATGTTTGAGGGACACCAAGGACCAATCACTGGCATCCATTGTCATGCAGCCGTTGGAGCAGTAGACTTCTCACATCTTTTTGTCACTTCATCATTTGACTGGACAGTAAAACTTTGGACAACTAAGAATAACAAGCCTTTATACTCATTTGAAGATAATTCAGACTACGTTTATGATGTTATGTGGTCACCCACCCACCCAGCCCTCTTTGCCTGTGTGGATGGCATGGGGAGGCTAGATTTGTGGAATCTCAATAACGACACGGAGGTGCCAACTGCCAGCATTTCCGTGGAGGGTAATCCTGCTCTTAATCGTGTAAGATGGACCCATTCTGGAAGAGAGATTGCCGTGGGTGATTCTGAAGGACAGATTGTTATATATGATGTGGGAGAGCAAATTGCTGTCCCCCGAAATGATGAATGGGCACGGTTCGGCCGAACACTTGCAGAAATTAATGCAAATCGAGCTGATGCAGAGGAGGAGGCTGCTACCCGAATACCTGCGTAGCTCCTGAAAATGGGATATGTAGCCTTAGTGGATTTGGGGAAGACTTTAAGTAGATCCTGAGACTATTTGCATGCTTCTGTCTAAATGATAATTAAAAGGAACTTTGGTGGATTAAACCATGGATTTAATGCAGCAAGCAATTCTTACAATGTCCCTTTTTATATAACATGCATCCTGTTTTGGATTTATGTCATTTTTAATACAGCTTATCGACTTTACTGAATGCAGCCTCTTTTGAATTCTTATACACAGGTGTATATTTGGTATTAGTTATTATTTTGAATTATTTTCAACTTATAACACTATATACAGTTATTTCTAAAGCACAAATTAAATAACTTCTGCATATTTTTAAGTAATCATAATTCCCTGTTATACTGATAAAGTTCTAACTTAATATGTGGGAACATTGTTCATTCTTAGCCATAGCATGCATACATCTATCCAAGTTATGTTCTAATATCTTTTTTCTTCTTTATAATTCATGTGATAGCTGTATATAAATAAAAACAAATATGATTTAACTTTTCAAA