Transcript asmbl_58809

Sequence
Transcript Sequence for observation asmbl_58809 of TGE0006507:
GAGGCCGGGAGCTGCTTCCCGGGCGGCGCGGAACCTGGCAACGGGCTGAAGCAGCGCAAGAGGCCGCGCGAGAACAAAGAAGTGCCCCGGGCCAGCCTGCTCAGCTTCCAGGACGAGGAGGAAGAAAATGAAGAAGTTTTTAAAGTGAAGAAATCAAGTTATAGCAAAAAGATTGTAAAATTACTTAAGAAAGAATATAAAGAAGATCTTGAAAAATCAAAGATTAAGACAGATGTCAACTCATCAGCTGACAATGAACCACCTTTGGACAAAACAGGACATGTTAAGGACACCAGTCAAGAAGATGGAGTTATTATTAGTGAACATGGTGAAGATGAAATGGATATGGAAAGTGAGAAGGAAGAAGAAAAGCCCAAGGCTGGGGGAGCCTTTTCAAATGCTTTATCTTCTTTGAATGTTCTCCGTCCAGGAGAAATTCCAGATGCAGCTTTCATACATGCTGCAAGGAAAAAGCGTCAGATGGCCCGGGAATTGGGAGATTTCACTCCTCATGATAGTGAGCCTGGTAAAGGCCGCCTTGTTAGAGAAGATGAGAATGATGCCAGCGATGATGAAGATGATGATGAGAAACGCCGTATAGTATTTTCTGTGAAAGAAAAGTCTCAAAGACAAAAAATTGCCGAGGAAATAGGTATTGAGGGGAGTGACGATGATGCTTTAGTAACTGGAGAACAGGATGAAGAGCTCAGCCGATGGGAACAGGAGCAGATAAGAAAAGGAATTAATATTCCTCAGGTTCAAGCAAGTCAGCCTACTGAAGTGAATATGTACTACCAGAACACTTACCAGACAATGCCTTACGGTTCATCCTATGGCATTCCTTATAGTTATACAGCCTATGGATCATCCGATGCCAAATCTCAAAAATCAGATAATACAGTCCCTTTCAAAACTCCCAGTAATGAGATGACTCCCGTTACTATTGATTTGGTAAAGAAACAGCTTAAAGACAGGTTGGACTCCATGAAAGAACTACACAAAACAAATCGACAGCAGCATGAGAAACATCTGCAAAGCCGAGTGGACTCTACCAGGGCTATTGAAAGATTAGAAGGGTCTTCTGGGGGTATTGGTGAACGGTATAAATTTTTGCAAGAAATGCGAGGGTATGTCCAAGACTTGCTTGAGTGTTTCAGTGAAAAGGTGCCACTGATTAATGAACTTGAATCAGCATTACATCAGCTGTACAAACAGCGAGCTTCCCGCCTTGTCCAAAGACGACAAGATGATATTAAAGATGAATCTTCGGAGTTTTCAAGCCATTCAAGTCAGTCCATCTTGAAGATAAAGCTCTGATGGCACCAAATCTTGATTCTTTTGGACGAGATCGGGCACTGTATCAAGAACACGCGAAACGTCGGATTGCAGAACGGGAGGCCAGGAGGACTCGGCGTCGACAAGCCAGAGAGCAAACCGGTAAGATGGCAGATCACCTCGAAGGCCTTTCCAGTGATGATGAAGAAACGTCTACAGATATTACAAATTTCAACCTGGAAAAAGATCGCATTTCAAAAGAGTCCAGCAAGGTTTTTGAAGATGTCCTTGAGAGCTTCTATTCAATTGACTGTATTAAATCTCAATTTGAAGCATGGCGTTCAAAATACTACATGTCCTACAAGGATGCTTACATTGGCCTTTGTTTGCCAAAGTTGTTCAACCCCCTCATAAGGCTGCAGCTTCTCACTTGGACTCCTCTTGAGGCAAAATGTCGTGACTTTGAAAATATGCTGTGGTTTGAATCTTTGCTGTTTTATGGTTGCGAAGAACGAGAGCAAGAAAAAGATGACGTGGATGTCGCACTATTACCTACTATTGTGGAAAAGGTGATTCTTCCAAAACTAACAGTGATAGCTGAAAATATGTGGGATCCTTTTTCTACAACACAGACTTCACGAATGGTTGGAATTACGTTAAAATTAATAAATGGATATCCTTCAGTAGTGAACGCAGAAAACAAAAATACACAGGTGTACCTAAAAGCACTTTTATTGAGAATGCGAAGAACTTTAGATGATGATGTATTCATGCCCTTATATCCCAAAAATGTCTTAGAAAATAAAAATTCTGGGCCTTATTTGTTTTTTCAACGACAGTTTTGGTCTTCAGTTAAGCTATTAGGGAATTTTCTTCAATGGTACGGCATTTTCTCAAATAAAACTCTTCAGGAGTTATCAATAGATGGTTTATTAAATAGATACATTCTCATGGCTTTTCAGAATTCAGAATATGGAGATGACAGCATCAAAAAAGCCCAAAATGTAATCAATTGTTTCCCCAAGCAGTGGTTCATGAACCTGAAAGGAGAAAGAACTATTTCTCAGTTAGAAAACTTCTGTCGGTACCTTGTGCACTTAGCAGATACAATTTACAGAAACAGCATTGGGTGCTCTGATGTGGAAAAAAGAAACGCAAGGGAAAACATAAAACAGATAGTAAAACTCCTTGCAAGTGTTCGAGCTCTGGATCATGCTATGTCTGTTGCAAGTGACCATAATGTGAAAGAATTTAAGTCTTTGATTGAAGGAAAATAGATCTATGAGACTGAAAAGCCTATTTGCTTTAATATCATTCCCAATGTATAAATTTTGTATATATGTAAAGTTTCTTAAACTGTAAAATACTGATTCTCGTTTTAATACAAAGAACATTATTAATATTCAATACTGTGTCCTTAAATGCAATTTCTTCGGAATGAAAGGAATTTAGATTATTTCTAGGAAGTTTATGAATGTTTTCCTTACTGCCTGTCATACTTTGTTTACAGACGTATTTTATATAGTCATTCAAATTAACTCGCTCAATTAATTGTTCTCTGTAAACGATGTGTGCAGTGTAAATTGTGTAATTATGCATATATATATTTATACCACCATGGCGTTACTTTCACACTGGAAATTTGTGATGTTTTTCTACAGAGTAAGCCTTTTAACAGCAGAAAATTATTCAGTAGCAAATTGTCTTAGGGAAATTACTACACTGTTGCAACAAAAGGGCTGGCAAGTGACTAAGTGTTCATCACCTTTTGGTTAGCAGTTGCTGTCACTGTCGCTGTGCTGCCTTAAACTTGAGAGTTGAGTGTGGACTTGATCAGTGGGTGAATGGTGAACTTTCTTCCTTGAATCAGCATGACAGTCAAATGTGGGTTTAATGTGAACTCTAATATATGCAACATAAGTTTTTGAAAAGAACATAGGAGTTTAATTTTTGGAAATAGACCCACAACCTAACTGTATGGTTTGGGGCTGACTGTCCTGTCTCATTCATGATTTTATTCCCTGACCAGCTTACAAATACGT